Cxcl12 (NM_001033883) Rat Untagged Clone
CAT#: RN200482
Cxcl12 (untagged ORF) - Rat chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1) (Cxcl12), transcript variant 3, (10 ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | Sdf1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN200482 representing NM_001033883
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACGCCAAGGTCGTCGCCGTGCTGGCCCTGGTGCTGGCCGCGCTCTGCATCAGTGACGGTAAGCCAG TCAGCCTGAGCTACAGATGCCCCTGCCGATTCTTTGAGAGCCATGTCGCCAGAGCCAACGTCAAACATCT GAAAATCCTCAACACTCCAAACTGTGCCCTTCAGATTGTTGCAAGGCTGAAAAGCAACAACAGACAAGTG TGCATTGACCCGAAATTAAAGTGGATCCAAGAGTACCTGGACAAAGCCTTAAACAAGGGGCGCAGAGAAG AAAAAGTGGGGAAAAAAGAAAAGATAGGAAAAAAGAAGCGACAGAAGAAGAGAAAGGCGGCCCAGAAAAA GAAAAACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001033883 |
Insert Size | 360 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001033883.1, NP_001029055.1 |
RefSeq Size | 5423 bp |
RefSeq ORF | 360 bp |
Locus ID | 24772 |
Gene Summary | a chemoattractant molecule; involved in cell migration [RGD, Feb 2006] Transcript Variant: This variant (3) uses an alternate 3' structure compared to variant 1, resulting in a novel 3' coding region and longer 3' UTR. It encodes isoform gamma which is longer and has a distinct C-terminus, compared to isoform alpha. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR200482 | Cxcl12 (Myc-DDK-tagged ORF) - Rat chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1) (Cxcl12), transcript variant 3, (10 ug) |
CNY 3990.00 |
|
RR200482L3 | Lenti ORF clone of Cxcl12 (Myc-DDK-tagged ORF) - Rat chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1) (Cxcl12), transcript variant 3, (10 ug) |
CNY 6080.00 |
|
RR200482L4 | Lenti ORF clone of Cxcl12 (mGFP-tagged ORF) - Rat chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1) (Cxcl12), transcript variant 3, (10 ug) |
CNY 6650.00 |