Mbp (NM_001025289) Rat Untagged Clone

CAT#: RN200507

Mbp (untagged ORF) - Rat myelin basic protein (Mbp), transcript variant 6, (10 ug)



  "NM_001025289" in other vectors (3)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Mbps
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN200507 representing NM_001025289
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGAAACCACTCTGGAAAGCGAGAATTAGCATCTGAGAAGGCCAGTAAGGATGGTGAGATTCACCGAG
GAGAGGCTGAAAAAAAGAGAAGCGTTGGCAAGCTTTCTCAGACCGCCTCAGAAGACAGTGATGTGTTTGG
GGAGGCAGATGCGATCCAGAACAATGGGACCTCGGCCGAGGACACAGCGGTGACAGACTCCAAGCACACA
GCAGACCCAAAGAATAACTGGCAGGGTGCCCACCCAGCTGACCCAGGGAACCGCCCCCACTTGATCCGCC
TCTTTTCCCGAGATGCCCCGGGAAGGGAGGACAACACCTTCAAAGACAGGCCCTCAGAGTCCGACGAGCT
TCAGACCATCCAAGAAGATCCCACAGCAGCTTCCGAAGGCCTGGATGTGATGGCATCACAGAAGAGACCC
TCACAGCGACACGGATCCAAGTACTTGGCCACAGCAAGTACCATGGACCATGCCCGGCATGGCTTCCTCC
CAAGGCACAGAGACACGGGCATCCTTGACTCCATCGGGCGCTTCTTTAGCGGTGACAGGGGTGCGCCCAA
GCGGGGCTCTGGCAAGGTGAGCTCCGAGGCGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001025289
Insert Size 594 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001025289.1, NP_001020460.1
RefSeq Size 1495 bp
RefSeq ORF 594 bp
Locus ID 24547
Gene Summary The protein encoded by the classic Mbp gene is a major constituent of the myelin sheath of oligodendrocytes and Schwann cells in the nervous system. However, Mbp-related transcripts are also present in the bone marrow and the immune system. These mRNAs arise from the long Mbp gene (otherwise called "Golli-Mbp") that contains 3 additional exons located upstream of the classic Mbp exons. Alternative splicing from the Golli and the Mbp transcription start sites gives rise to 2 sets of Mbp-related transcripts and gene products. The Golli mRNAs contain 3 exons unique to Golli-Mbp, spliced in-frame to 1 or more Mbp exons. They encode hybrid proteins that have N-terminal Golli aa sequence linked to Mbp aa sequence. The second family of transcripts contain only Mbp exons and produce the well characterized myelin basic proteins. This complex gene structure is conserved among species suggesting that the Mbp transcription unit is an integral part of the Golli transcription unit and that this arrangement is important for the function and/or regulation of these genes. Mutation of the Mbp gene is associated with the 'shiverer' and 'myelin deficient' phenotypes in mouse. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (6) contains 3 exons unique to Golli-Mbp and exon 1 of the classic Mbp. It encodes Golli-mbp isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...