Rap1a (NM_001005765) Rat Untagged Clone
CAT#: RN201148
Rap1a (untagged ORF) - Rat RAP1A, member of RAS oncogene family (Rap1a), (10 ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | RAP-1A; rap 1A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN201148 representing NM_001005765
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCGTGAGTACAAGCTAGTGGTCCTTGGTTCAGGAGGCGTGGGAAAGTCTGCTCTGACAGTTCAGTTTG TTCAGGGAATTTTTGTTGAAAAATATGACCCAACGATAGAAGATTCCTACAGAAAGCAAGTCGAAGTAGA TTGCCAACAGTGTATGCTGGAAATCCTGGACACCGCAGGGACAGAGCAATTTACAGCAATGAGGGATTTG TATATGAAGAATGGCCAAGGGTTTGCACTAGTTTATTCAATTACAGCTCAGTCTACGTTTAATGACTTAC AAGACTTGAGAGAACAGATTTTACGGGTTAAAGACACAGAAGATGTTCCAATGATTTTGGTTGGCAATAA ATGTGATCTGGAAGATGAGCGGGTAGTTGGCAAAGAACAAGGCCAGAATTTAGCAAGACAGTGGTGTAAC TGTGCCTTTTTAGAATCTTCTGCAAAGTCAAAGATCAACGTTAATGAGATATTTTATGACCTGGTCAGAC AGATAAATAGAAAAACACCAGTGGAAAAGAAGAAGCCTAAAAAGAAATCATGTCTGCTGCTCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001005765 |
Insert Size | 555 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001005765.1, NP_001005765.1 |
RefSeq Size | 2458 bp |
RefSeq ORF | 555 bp |
Locus ID | 295347 |
UniProt ID | P62836 |
Gene Summary | Induces morphological reversion of a cell line transformed by a Ras oncogene. Counteracts the mitogenic function of Ras, at least partly because it can interact with Ras GAPs and RAF in a competitive manner. Together with ITGB1BP1, regulates KRIT1 localization to microtubules and membranes (By similarity). Plays a role in nerve growth factor (NGF)-induced neurite outgrowth. Plays a role in the regulation of embryonic blood vessel formation. Involved in the establishment of basal endothelial barrier function. May be involved in the regulation of the vascular endothelial growth factor receptor KDR expression at endothelial cell-cell junctions.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR201148 | Rap1a (Myc-DDK-tagged ORF) - Rat RAP1A, member of RAS oncogene family (Rap1a), (10 ug) |
CNY 3990.00 |
|
RR201148L3 | Lenti ORF clone of Rap1a (Myc-DDK-tagged ORF) - Rat RAP1A, member of RAS oncogene family (Rap1a), (10 ug) |
CNY 6080.00 |
|
RR201148L4 | Lenti ORF clone of Rap1a (mGFP-tagged ORF) - Rat RAP1A, member of RAS oncogene family (Rap1a), (10 ug) |
CNY 6650.00 |