Dio2 (NM_031720) Rat Untagged Clone

CAT#: RN201204

Dio2 (untagged ORF) - Rat deiodinase, iodothyronine, type II (Dio2), (Note, selenocysteine protein, internal stop codon, see reference data summary)



  "NM_031720" in other vectors (1)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Synonyms 5DII; DIOII
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN201204 representing NM_031720
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGACTCCTCAGCGTAGACTTGCTGATCACTCTTCAGATTCTGCCAGTCTTTTTCTCCAACTGCCTCT
TCCTGGCGCTCTATGACTCGGTCATTCTGCTCAAGCACGTGGCGCTGCTTCTCAGCCGCTCCAAGTCCAC
TCGCGGAGAGTGGAGGCGCATGCTGACCTCAGAAGGACTACGCTGTGTCTGGAACAGCTTTCTCCTAGAC
GCCTACAAACAGGTTAAATTGGGTGAAGATGCTCCCAATTCCAGTGTGGTGCACGTGTCCAATCCTGAAG
CAGGTAACAATTGTGCCTCAGAGAAGACGGCGGATGGGGCTGAATGCCACCTTCTTGACTTTGCCAGTGC
AGAGCGCCCACTGGTGGTCAACTTTGGTTCAGCGACCTGACCACCTTTTACTAGGCAACTGCCAGCCTTC
CGCCAGTTGGTGGAAGAGTTCTCCTCGGTGGCTGACTTCCTGTTGGTATACATTGATGAGGCTCACCCTT
CAGATGGCTGGGCAGTGCCTGGGGACTCCTCTATGTCTTTTGAGGTTAAGAAGCACCGGAACCAAGAGGA
CCGATGTGCTGCAGCCCACCAGCTCCTGGAGCGTTTCTCCTTGCCGCCCCAGTGTCAAGTTGTGGCTGAC
CGCATGGACAATAATGCCAACGTAGCTTATGGGGTAGCCTTTGAACGTGTGTGCATCGTGCAGAGACGGA
AAATTGCTTACTTAGGAGGGAAGGGCCCCTTCAGCTATAACCTGCAAGAAGTCCGAAGTTGGCTGGAGAA
GAATTTCAGCAAGAGATGAATTCTAGATTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_031720
Insert Size 801 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_031720.4, NP_113908.3
RefSeq Size 6301 bp
RefSeq ORF 789 bp
Locus ID 65162
UniProt ID P70551
Gene Summary The protein encoded by this gene belongs to the iodothyronine deiodinase family. It catalyzes the conversion of prohormone thyroxine (3,5,3',5'-tetraiodothyronine, T4) to the bioactive thyroid hormone (3,5,3'-triiodothyronine, T3) by outer ring 5'-deiodination. This gene is expressed in a few tissues in rat, including brain, pituitary and brown adipose tissue. It is thought to be responsible for the 'local' production of T3, and thus important in influencing thyroid hormone action in these tissues. Studies in rat suggest that this gene may play an important role in the regulation of lipid metabolism and thermogenesis, and in osteoarthritis pathogenesis by enhancing the chondrocyte hypertrophy and inflammatory response. This protein is a selenoprotein containing the non-standard amino acid, selenocysteine (Sec), which is encoded by the UGA codon that normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Unlike the other two members (DIO1 and DIO3) of this enzyme family, the mRNA for this gene contains an additional in-frame UGA codon that has been reported (in human) to function either as a Sec or a stop codon, resulting in two potential isoforms with one or two Sec residues; however, only the upstream Sec (conserved with the single Sec residue found at the active site in DIO1 and DIO3) was shown to be essential for enzyme activity (PMID:10403186). In addition, the lack of conservation of the protein extension past the second TGA codon suggests that the one-Sec containing isoform represents the canonical form. [provided by RefSeq, Oct 2018]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...