Azin1 (NM_022585) Rat Untagged Clone

CAT#: RN206887

Azin1 (untagged ORF) - Rat antizyme inhibitor 1 (Azin1), (10 ug)



  "NM_022585" in other vectors (3)

CNY 5800.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Oazi; Oazin
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN206887 representing NM_022585
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAAGGATTTATTGACGATGCAAACTACTCCGTTGGCCTGTTGGATGAAGGAACAAACCTTGGAAATG
TTATTGATAACTATGTTTATGAACATACCCTGACAGGAAAAAATGCATTTTTTGTGGGGGATCTTGGGAA
GATCGTGAAGAAGCACAGTCAGTGGCAGAACGTGGTGGCTCAGATAAAGCCATTTTACATGGTGAAGTGC
AACTCCACTCCAGCCGTACTGGAGATCTTGGCAGCTCTTGGAACTGGATTTGCTTGTTCCAGCAAAAATG
AAATGGCTTTAGTGCAAGAATTAGGCGTATCTCCAGAAAACATCATTTATACAAGTCCTTGTAAGCAAGC
ATCTCAGATAAAGTACGCAGCAAAAGTTGGAGTAAATATTATGACATGTGACAATGAAGTTGAATTAAAG
AAAATTGCGAGGAATCACCCAAATGCCAAGGTCTTACTACATATTGCAACAGAAGATAATATTGGAGGTG
AAGATGGTAATATGAAGTTTGGCACTACACTGAAGAACTGTAGGCATCTTTTGGAATGTGCCAAGGAACT
TGATGTCCAAATAATTGGGGTTAAATTTCATATTTCAAGTGCTTGCAAAGAATATCAAGTCTATGTCCAT
GCCCTGTCTGATGCTCGATGTGTGTTTGACATGGCTGGGGAGTTTGGCTTTACAATGAACATGTTAGACA
TCGGTGGAGGCTTCACAGGAACTGAAATTCAGTTGGAAGAGGTTAATCATGTTATCAGTCCTCTGTTGGA
TATTTACTTCCCTGAAGGATCTGGCATTCAGATCATTTCCGAACCTGGAAGCTACTATGTATCTTCTGCA
TTTACGCTTGCAGTCAATATTATTGCTAAGAAAGTTGTTGAAAATGATAAATTATCCTCTGGAGTAGAAA
AAAATGGGAGTGACGAGCCAGCCTTCGTGTACTACATGAATGACGGTGTTTATGGTTCTTTTGCAAGTAA
GCTTTCTGAGGACTTAAATACTGTTCCAGAGGTTCACAAGAAATACAAGGAAGATGAGCCTCTGTTTACA
AGCAGCCTTTGGGGTCCATCCTGTGACGAGCTTGATCAAATTGTGGAAAGTTGTCTTCTTCCTGAGCTGA
GCGTGGGAGATTGGCTTATCTTTGATAACATGGGAGCAGATTCTTTGCACGGACCGTCTGCTTTTAGTGA
CACTCAGAGGCCAGCTATTTATTTCATGATGTCACTCAGTGATTGGTATGAGATGCAAGATGCTGGAATT
ACTTCAGATGCAATGATGAAAAACTTCTTCTTTGCACCCTCTTGCATTCAGCTGAGCCAAGAAGACAACT
TCTCCACTGAAGCTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_022585
Insert Size 1347 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_022585.2, NP_072107.2
RefSeq Size 4344 bp
RefSeq ORF 1347 bp
Locus ID 58961
Gene Summary The protein encoded by this gene belongs to the antizyme inhibitor family, which plays a role in cell growth and proliferation by maintaining polyamine homeostasis within the cell. Antizyme inhibitors are homologs of ornithine decarboxylase (ODC, the key enzyme in polyamine biosynthesis) that have lost the ability to decarboxylase ornithine; however, retain the ability to bind to antizymes. Antizymes negatively regulate intracellular polyamine levels by binding to ODC and targeting it for degradation, as well as by inhibiting polyamine uptake. Antizyme inhibitors function as positive regulators of polyamine levels by sequestering antizymes and neutralizing their effect. This gene encodes antizyme inhibitor 1, the first member of this gene family that is ubiquitously expressed, and is localized in the nucleus and cytoplasm. Overexpression of antizyme inhibitor 1 gene has been associated with increased proliferation, cellular transformation and tumorigenesis. Gene knockout studies showed that homozygous mutant mice lacking functional antizyme inhibitor 1 gene died at birth with abnormal liver morphology. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...