Pcp4 (NM_013002) Rat Untagged Clone
CAT#: RN207279
Pcp4 (untagged ORF) - Rat Purkinje cell protein 4 (Pcp4), (10 ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | pep-19; PEPZ19 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN207279 representing NM_013002
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGTGAGAGACAAAGTGCTGGAGCGACCAATGGAAAAGACAAGACATCAGGAGATAATGATGGGCAGA AGAAGGTCCAAGAAGAATTTGATATCGACATGGATGCACCAGAGACAGAGCGTGCAGCTGTGGCCATTCA GTCTCAGTTCAGAAAATTCCAGAAGAAAAAGGCAGGATCACAGTCCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_013002 |
Insert Size | 189 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_013002.4, NP_037134.1 |
RefSeq Size | 571 bp |
RefSeq ORF | 189 bp |
Locus ID | 25510 |
UniProt ID | P63055 |
Gene Summary | The protein encoded by this gene regulates H1˚ and H3.3 histone synthesis by binding to H1˚ and H3.3 histone mRNAs. The encoded protein can bind calmodulin as well, providung a possible link between calcium-dependent signals and histone metabolism. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (1) represents the predominant transcript and encodes the smaller isoform (PEP19). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR207279 | Pcp4 (Myc-DDK-tagged ORF) - Rat Purkinje cell protein 4 (Pcp4), (10 ug) |
CNY 3990.00 |
|
RR207279L3 | Lenti ORF clone of Pcp4 (Myc-DDK-tagged ORF) - Rat Purkinje cell protein 4 (Pcp4), (10 ug) |
CNY 6080.00 |
|
RR207279L4 | Lenti ORF clone of Pcp4 (mGFP-tagged ORF) - Rat Purkinje cell protein 4 (Pcp4), (10 ug) |
CNY 6650.00 |