Rnf2 (NM_001025667) Rat Untagged Clone

CAT#: RN207712

Rnf2 (untagged ORF) - Rat ring finger protein 2 (Rnf2), (10 ug)



  "NM_001025667" in other vectors (3)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms MGC114502
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN207712 representing NM_001025667
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTCAGGCTGTGCAGACAAATGGAACTCAACCATTAAGCAAGACATGGGAGCTCAGTTTGTACGAAT
TACAACGGACACCTCAGGAGGCAATAACAGATGGCTTGGAAATCGTGGTTTCACCTAGAAGTCTTCACAG
TGAGTTGATGTGCCCAATTTGTTTGGATATGTTGAAGAACACCATGACCACAAAGGAGTGCTTACATCGC
TTTTGTGCGGATTGCATTATCACGGCCCTCAGAAGTGGCAACAAAGAATGCCCTACCTGTCGGAAAAAAC
TGGTTTCTAAAAGATCACTAAGGCCAGATCCAAATTTTGATGCACTCATCAGCAAGATTTATCCGAGCCG
TGATGAGTATGAAGCTCATCAAGAGAGAGTATTAGCTAGGATCAACAAGCACAACAATCAGCAGGCCCTC
AGCCACAGCATTGAGGAGGGGCTGAAGATACAGGCCATGAACAGATTACAGCGAGGCAAAAAGCAGCAGA
TTGAAAATGGCAGCGGAGCAGAAGATAATGGTGACAGTTCCCATTGCAGTAATGCGTCCACACACAGCAA
TCAGGAAGCCGGCCCCAGTAACAAACGGACCAAGACCTCAGATGACTCTGGGCTTGAACTCGACAACAAC
AATGCAGCAGTGGCAATCGATCCAGTGATGGATGGTGCCAGTGAGATTGAGTTGGTATTCAGGCCCCACC
CAACTCTTATGGAGAAGGACGACAGCGCACAGACCAGATACATAAAGACTTCAGGCAATGCCACTGTTGA
TCACTTATCCAAGTACCTGGCCGTGAGGTTAGCTTTAGAAGAGCTTCGAAGCAAAGGAGAGTCAAACCAG
ATGAACCTGGATACAGCCAGTGAAAAGCAGTACACCATTTACATAGCTACAGCCAGTGGCCAGTTCACTG
TGAGTATTTGTCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001025667
Insert Size 927 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001025667.1, NP_001020838.1
RefSeq Size 2418 bp
RefSeq ORF 927 bp
Locus ID 304850
UniProt ID Q4KLY4
Gene Summary E3 ubiquitin-protein ligase that mediates monoubiquitination of 'Lys-119' of histone H2A (H2AK119Ub), thereby playing a central role in histone code and gene regulation. H2AK119Ub gives a specific tag for epigenetic transcriptional repression and participates in X chromosome inactivation of female mammals. May be involved in the initiation of both imprinted and random X inactivation. Essential component of a Polycomb group (PcG) multiprotein PRC1-like complex, a complex class required to maintain the transcriptionally repressive state of many genes, including Hox genes, throughout development. PcG PRC1 complex acts via chromatin remodeling and modification of histones, rendering chromatin heritably changed in its expressibility. E3 ubiquitin-protein ligase activity is enhanced by BMI1/PCGF4. Acts as the main E3 ubiquitin ligase on histone H2A of the PRC1 complex, while RING1 may rather act as a modulator of RNF2/RING2 activity. Plays a role in the transcriptional repression of genes that are required for pluripotency in embryonic stem cells, thereby contributing to differentiation of the ectodermal and endodermal germ layers. Association with the chromosomal DNA is cell-cycle dependent. In resting B- and T-lymphocytes, interaction with AURKB leads to block its activity, thereby maintaining transcription in resting lymphocytes.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...