H2afj (NM_001109610) Rat Untagged Clone
CAT#: RN208904
H2afj (untagged ORF) - Rat H2A histone family, member J (H2afj), (10 ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | H2a/j |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN208904 representing NM_001109610
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCCGGGCGAGGCAAGCAGGGGGGTAAGGTGCGGGCCAAGGCCAAGTCGCGCTCGTCGCGCGCGGGCC TCCAGTTCCCCGTGGGCCGTGTTCACCGGCTGCTGCGCAAGGGCAACTACGCGGAGCGCGTGGGCGCGGG AGCGCCCGTGTACCTGGCGGCGGTGCTGGAGTACCTGACGGCCGAGATCCTGGAACTGGCGGGCAACGCG GCGAGGGACAACAAGAAGACGCGCATCATCCCTCGCCACCTGCAGCTGGCTATCCGCAACGACGAAGAGC TCAACAAGCTTCTGGGCCGTGTGACCATCGCGCAGGGCGGTGTCCTGCCCAACATCCAGGCCGTGCTGCT GCCCAAGAAGACGGAGAGCCAGAAGGTGAAGAGCAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001109610 |
Insert Size | 390 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001109610.2, NP_001103080.1 |
RefSeq Size | 510 bp |
RefSeq ORF | 390 bp |
Locus ID | 690795 |
UniProt ID | A9UMV8 |
Gene Summary | Core component of nucleosome. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR208904 | H2afj (Myc-DDK-tagged ORF) - Rat H2A histone family, member J (H2afj), (10 ug) |
CNY 3990.00 |
|
RR208904L3 | Lenti ORF clone of H2afj (Myc-DDK-tagged ORF) - Rat H2A histone family, member J (H2afj), (10 ug) |
CNY 6080.00 |
|
RR208904L4 | Lenti ORF clone of H2afj (mGFP-tagged ORF) - Rat H2A histone family, member J (H2afj), (10 ug) |
CNY 6650.00 |