Tmem100 (NM_001017479) Rat Untagged Clone
CAT#: RN210875
Tmem100 (untagged ORF) - Rat transmembrane protein 100 (Tmem100), (10 ug)
CNY 3990.00
Cited in 1 publication. |
Product images

Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | MGC108778 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN210875 representing NM_001017479
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGACTGAAGAACCCACAAAAGAGAACCTGGGAGGCCCGAAGTCTCCCACACCTGTGACAATGGAGAAAA GCCCCAAGAGTGAAGTTGTGGTCACCACGGTCCCCTTGGTCAGTGAGGTTCAGCTGACGGCCGCCACCGG GGGTGCCGAACTCTCTTGCTACCGCTGCATCATCCCCTTTGCCGTGGTGGTCTTCATCACCGGGATCGTG GTCACCGCTGTAGCTTACAGCTTCAATTCCCATGGTTCCGTCATCTCCATCTTAGGCCTGGTCCTTCTGT CCTCTGGACTGTTTTTACTAGCCTCCAGCGCGTTGTGCTGGAAGGTGAGACAAAGGAACAAAAAAGTCAA GAGACGCGAGAGTCAGACGGCTCTGGTGGTAAATCAGAGAAGTTTGTTTGCTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001017479 |
Insert Size | 405 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001017479.1, NP_001017479.1 |
RefSeq Size | 1424 bp |
RefSeq ORF | 405 bp |
Locus ID | 497979 |
UniProt ID | Q569C0 |
Gene Summary | Plays a role during embryonic arterial endothelium differentiation and vascular morphogenesis through the ACVRL1 receptor-dependent signaling pathway upon stimulation by bone morphogenetic proteins, such as GDF2/BMP9 and BMP10. Involved in the regulation of nociception, acting as a modulator of the interaction between TRPA1 and TRPV1, two molecular sensors and mediators of pain signals in dorsal root ganglia (DRG) neurons. Mechanistically, it weakens their interaction, thereby releasing the inhibition of TRPA1 by TRPV1 and increasing the single-channel open probability of the TRPA1-TRPV1 complex.[UniProtKB/Swiss-Prot Function] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Transmembrane protein 100 is expressed in neurons and glia of dorsal root ganglia and is reduced after painful nerve injury
,Yu, H;Shin, SM;Wang, F;Xu, H;Xiang, H;Cai, Y;Itson-Zoske, B;Hogan, QH;,
Pain Rep
,PubMed ID 30801043
[TMEM100]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR210875 | Tmem100 (Myc-DDK-tagged ORF) - Rat transmembrane protein 100 (Tmem100), (10 ug) |
CNY 3990.00 |
|
RR210875L3 | Lenti ORF clone of Tmem100 (Myc-DDK-tagged ORF) - Rat transmembrane protein 100 (Tmem100), (10 ug) |
CNY 6080.00 |
|
RR210875L4 | Lenti ORF clone of Tmem100 (mGFP-tagged ORF) - Rat transmembrane protein 100 (Tmem100), (10 ug) |
CNY 6650.00 |
其它Tmem100产品