Mdh1 (NM_033235) Rat Untagged Clone

CAT#: RN210984

Mdh1 (untagged ORF) - Rat malate dehydrogenase 1, NAD (soluble) (Mdh1), (10 ug)



  "NM_033235" in other vectors (3)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Mdhl; MDL1; Mor2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN210984 representing NM_033235
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTGAGCCAATCAGAGTCCTCGTGACAGGAGCAGCCGGTCAGATTGCATATTCGCTGCTGTACAGCA
TTGGAAATGGATCTGTCTTTGGGAAAGACCAGCCCATCATTCTTGTGCTGTTGGACATCACCCCCATGAT
GGGTGTTCTGGACGGTGTCCTGATGGAGCTGCAAGACTGTGCCCTTCCCCTTCTGCAGGATGTCATTGCA
ACAGACAAAGAAGAGGTTGCCTTCAAAGACCTGGACGTGGCTGTCCTTGTGGGCTCCATGCCAAGAAGGG
AGGGCATGGAGAGGAAGGACCTACTGAAAGCCAACGTGAAGATCTTCAAATCCCAGGGCGCAGCCTTGGA
GAAGTACGCCAAGAAATCAGTTAAGGTCATTGTTGTGGGGAACCCAGCCAATACAAACTGCCTGACGGCC
TCCAAGTCAGCACCATCGATCCCCAAGGAGAACTTCAGTTGCCTGACTCGATTGGACCACAACCGAGCAA
AATCTCAAATTGCTCTTAAACTCGGTGTAACCGCTGATGATGTAAAAAATGTCATTATCTGGGGAAATCA
TTCATCAACCCAGTATCCAGATGTCAATCATGCCAAGGTGAAATTGCAAGGAAAAGAAGTTGGTGTGTAT
GAAGCCCTCAAAGACGACAGCTGGCTCAAGGGAGAGTTCATCACGACTGTGCAGCAGCGTGGTGCTGCTG
TCATCAAGGCTCGGAAGCTGTCCAGTGCCATGTCTGCTGCGAAGGCCATCTCGGACCACATCAGAGACAT
CTGGTTTGGAACCCCGGAGGGCGAGTTCGTGTCGATGGGCGTAATCTCTGATGGCAACTCCTATGGTGTC
CCTGATGACCTGCTCTACTCGTTCCCTGTCGTGATCAAGAATAAGACCTGGAAGTTTGTTGAAGGCCTCC
CCATTAACGACTTCTCCCGTGAGAAGATGGACCTGACAGCAAAGGAGCTGACCGAGGAAAAGGAAACGGC
TTTTGAGTTTCTCTCCTCCGCATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_033235
Insert Size 1005 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_033235.2, NP_150238.1
RefSeq Size 1878 bp
RefSeq ORF 1005 bp
Locus ID 24551
UniProt ID O88989
Gene Summary This gene encodes an enzyme that catalyzes the NAD/NADH-dependent, reversible oxidation of malate to oxaloacetate in many metabolic pathways, including the citric acid cycle. Two main isozymes are known to exist in eukaryotic cells: one is found in the mitochondrial matrix and the other in the cytoplasm. This gene encodes the cytosolic isozyme, which plays a key role in the malate-aspartate shuttle that allows malate to pass through the mitochondrial membrane to be transformed into oxaloacetate for further cellular processes. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is localized in the peroxisomes. [provided by RefSeq, Feb 2016]
Transcript Variant: This transcript (1) encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (Mdh1) results from translation termination at the upstream UGA stop codon, while the longer isoform (Mdh1x) results from UGA stop codon readthrough to the downstream UGA termination codon. This RefSeq represents the shorter isoform (Mdh1), which is localized in the cytosol.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...