Wdyhv1 (NM_001025024) Rat Untagged Clone
CAT＃: RN211157
Wdyhv1 (untagged ORF) - Rat similar to hypothetical protein FLJ10204 (RGD1311362), (10 ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Rat Untagged Clone |
| Tag | Tag Free |
| Synonyms | RGD1311362 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>RN211157 representing NM_001025024
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGGGGGACAGCCGCGCCGCCACGGCCTCGCAGTACCAGCCGGCCTGCCCTACGCGGGACGCATGTG TCTACAGCAGCTGCTATTGTGAGGAAAACATTTGGAAGCTCTGTGAATACATCAAAACACACAACCAGTA TCTGTTGGAGGAGTGCTACGCTGTCTTCATATCGAATGAGAAGAAGATGGTACCTATTTGGAAACAGCAG GCAAGACCTGAGAATGGACCTGTGATCTGGGATTATCATGTCGTTCTGCTTCATGTGTCAAGGGAAGGAC AGAGCTTCATTTATGACCTTGATACTATTTTGCCATTTCCCTGCCCTTTCGACATTTACATAGAAGATGC CCTTAAGTCTGATGATGACATTCATCCACAGTTTAGGAGGAAATTCAGAGTGGTTCGTGCTGACTCCTAC TTGAAGAACTTTGCTTCTGACCGGTCTCACATGAAGGACTCGAGTGGGAACTGGAGAGAGCCCCCTCCAG AGTACCCCTGCATTGAAACTGGAGACTCCAAAATGAACCTGAACGACTTCATCAGCATGGACCCTGCAGT AGGATGGGGAGCTGTCTACACGCTGTCTGAGTTTGTACATCGGTTCAGCAGCAAAAACTACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001025024 |
| Insert Size | 624 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001025024.1, NP_001020195.1 |
| RefSeq Size | 1442 bp |
| RefSeq ORF | 624 bp |
| Locus ID | 362914 |
| UniProt ID | Q5BJV9 |
| Gene Summary | Mediates the side-chain deamidation of N-terminal glutamine residues to glutamate, an important step in N-end rule pathway of protein degradation. Conversion of the resulting N-terminal glutamine to glutamate renders the protein susceptible to arginylation, polyubiquitination and degradation as specified by the N-end rule. Does not act on substrates with internal or C-terminal glutamine and does not act on non-glutamine residues in any position. Does not deaminate acetylated N-terminal glutamine. With the exception of proline, all tested second-position residues on substrate peptides do not greatly influence the activity. In contrast, a proline at position 2, virtually abolishes deamidation of N-terminal glutamine.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RR211157 | Wdyhv1 (Myc-DDK-tagged ORF) - Rat similar to hypothetical protein FLJ10204 (RGD1311362), (10 ug) |
CNY 3990.00 |
|
| RR211157L3 | Lenti ORF clone of Wdyhv1 (Myc-DDK-tagged ORF) - Rat similar to hypothetical protein FLJ10204 (RGD1311362), (10 ug) |
CNY 6080.00 |
|
| RR211157L4 | Lenti ORF clone of Wdyhv1 (mGFP-tagged ORF) - Rat similar to hypothetical protein FLJ10204 (RGD1311362), (10 ug) |
CNY 6650.00 |
