Lamtor1 (NM_199102) Rat Untagged Clone

CAT#: RN214200

Lamtor1 (untagged ORF) - Rat hypothetical LOC308869 (MGC72560), (10 ug)



  "NM_199102" in other vectors (3)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms p18
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN214200 representing NM_199102
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGTGCTGCTATAGCAGCGAAAACGAGGACTCGGACCAGGACCAGGAGGAGAGGAAGCTGTTGTTGG
ACCCCAGTAACACCCCTACCAAAGCCCTCAATGGAGCCGAGCCCAGCTACCATAGCCTGCCTTCAGCTCG
CACAGATGAGCAGGCCCTGCTTTCCTCCATCCTTGCCAAGACAGCTAGCAACATCATTGATGTGTCTGCC
GCAGACTCCCAGGGCATGGAGCAGCATGAGTACATGGACCGGGCAAGGCAGTACAGTACCCGCTTGGCTG
TGCTTAGCAGCAGTCTGACCCATTGGAAGAAGCTGCCACCGCTGCCATCTCTCACCAGCCAGCCCCACCA
AGTGCTGGCCAGCGAGCCTATCCCTTTCTCTGACTTGCAGCAGGTCTCCAGGATAGCTGCTTATGCCTAT
AGTGCACTTTCTCAGATCCGCGTGGATGCGAAAGAAGAGCTGGTTGTACAGTTTGGGATCCCATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_199102
Insert Size 486 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_199102.1, NP_954533.1
RefSeq Size 1118 bp
RefSeq ORF 486 bp
Locus ID 308869
UniProt ID Q6P791
Gene Summary As part of the Ragulator complex it is involved in amino acid sensing and activation of mTORC1, a signaling complex promoting cell growth in response to growth factors, energy levels, and amino acids. Activated by amino acids through a mechanism involving the lysosomal V-ATPase, the Ragulator functions as a guanine nucleotide exchange factor activating the small GTPases Rag. Activated Ragulator and Rag GTPases function as a scaffold recruiting mTORC1 to lysosomes where it is in turn activated. LAMTOR1 is directly responsible for anchoring the Ragulator complex to membranes. Also required for late endosomes/lysosomes biogenesis it may regulate both the recycling of receptors through endosomes and the MAPK signaling pathway through recruitment of some of its components to late endosomes. May be involved in cholesterol homeostasis regulating LDL uptake and cholesterol release from late endosomes/lysosomes. May also play a role in RHOA activation (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...