Ube2d2 (NM_001037292) Rat Untagged Clone
CAT#: RN214498
Ube2d2 (untagged ORF) - Rat ubiquitin-conjugating enzyme E2D 2 (Ube2d2), (10 ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | E217kB; Ubc2e |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN214498 representing NM_001037292
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTCTGAAGAGAATCCACAAGGAATTGAATGACCTGGCTCGAGATCCTCCAGCACAGTGTTCAGCAG GTCCTGTTGGAGATGATATGTTTCATTGGCAGGCTACAATAATGGGGCCAAATGACAGCCCCTATCAGGG TGGAGTATTTTTCTTGACTATTCATTTCCCAACAGATTACCCCTTCAAACCGCCTAAGGTTGCATTTACA ACAAGAATTTATCATCCAAATATTAACAGTAATGGCAGCATTTGTCTTGATATTCTACGGTCACAGTGGT CTCCAGCACTAACTATTTCAAAAGTACTTTTGTCCATCTGTTCTCTGTTGTGTGATCCCAATCCAGATGA TCCTTTAGTGCCTGAGATTGCTCGGATCTACAAAACAGATAGAGAAAAGTACAACAGAATAGCTCGGGAA TGGACTCAGAAGTATGCCATGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001037292 |
Insert Size | 444 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001037292.1, NP_001032369.1 |
RefSeq Size | 915 bp |
RefSeq ORF | 444 bp |
Locus ID | 641452 |
UniProt ID | P62839 |
Gene Summary | Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. In vitro catalyzes 'Lys-48'-linked polyubiquitination. Mediates the selective degradation of short-lived and abnormal proteins. Functions in the E6/E6-AP-induced ubiquitination of p53/TP53. Mediates autoubiquitination of STUB1 and TRAF6. Involved in the signal-induced conjugation and subsequent degradation of NFKBIA, FBXW2-mediated GCM1 ubiquitination and degradation, MDM2-dependent degradation of p53/TP53 and the activation of MAVS in the mitochondria by DDX58/RIG-I in response to viral infection. Essential for viral activation of IRF3 (By similarity). Mediates ubiquitination of PEX5.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR214498 | Ube2d2 (Myc-DDK-tagged ORF) - Rat ubiquitin-conjugating enzyme E2D 2 (Ube2d2), (10 ug) |
CNY 3990.00 |
|
RR214498L3 | Lenti ORF clone of Ube2d2 (Myc-DDK-tagged ORF) - Rat ubiquitin-conjugating enzyme E2D 2 (Ube2d2), (10 ug) |
CNY 6080.00 |
|
RR214498L4 | Lenti ORF clone of Ube2d2 (mGFP-tagged ORF) - Rat ubiquitin-conjugating enzyme E2D 2 (Ube2d2), (10 ug) |
CNY 6650.00 |