Ffar2 (NM_001005877) Rat Untagged Clone

CAT#: RN214546

Ffar2 (untagged ORF) - Rat free fatty acid receptor 2 (Ffar2), (10 ug)



  "NM_001005877" in other vectors (3)

CNY 3600.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Gpr43
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN214546 representing NM_001005877
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCCCAGACTGGCACAGTTCCTTGATCCTCACGGCCTACATCCTCATCTTTCTTACTGGGCTCCCTG
CCAACCTGCTGGCCCTGCGGGCCTTCGTGAGCCGGGTTCGCCAGCCCCAGCCTGCACCCGTGCACATCCT
CCTGCTTAATCTGACCCTGGCGGACTTGCTGTTGTTGCTGCTGCTGCCCTTCCGGATCGTGGAAGCTGCA
TCCAACTTCCGCTGGTACCTACCAAAGATCGTGTGCGCGCTCACGGGCTTCGGCTTCTACAGCAGTATCT
ACTGCAGCACGTGGCTGCTGGCGGGCATCAGCATAGAACGCTACCTGGGAGTGGCTTTCCCGGTGCAGTA
CAAGCTATCCCGCCGGCCACTGTACGGAGTGATCGCTGCTCTGGTGGCCTGGATCATGTCCTTTGGCCAT
TGCACCATCGTCATCATCGTTCAGTACCTGAACTCAACCGAGCAGGTGGGCACCGAGAACCAAATCACCT
GCTATGAGAACTTCACCCAAGCGCAGCTGGATGTGGTGCTGCCCGTGCGACTGGAGCTGTGCCTGGTCCT
CTTTTTCGTCCCCATGACAGTCACCATCTTCTGCTATTGGCGCTTTGTATGGATCATGCTCACACAGCCC
CATGTTGGGGCTCAGAGGCGACGCCGGGCGGTGGGCCTGGCTGTGGTGACGCTTCTTAATTTCCTGGTGT
GCTTTGGACCTTACAACATGTCCCACCTGGTGGGGTTCCACTTGAGGCAGAGTCCCTCGTGGCGGGTGGA
GGCTGTGGTGTTCAGTTCCCTCAATGCCAGCCTGGACCCTCTGCTATTCTACTTCTCCTCCTCCGTGGTA
CGCAGGGCCTTCGGGAAAGGTTTGCTACTACTCCGCAATCCCGGCTCCTCTATGCTGGGCAGGGGAGCCG
AAGAGACAGTGGAGGGGACCAAGACAGACAGGGGTGGGAGTCAAACAGAAGGGGCACAGAGCTCTGACTT
TGTCACCGAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_001005877
Insert Size 993 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001005877.1, NP_001005877.1
RefSeq Size 993 bp
RefSeq ORF 993 bp
Locus ID 292794
UniProt ID Q76EI6
Gene Summary G protein-coupled receptor that is activated by a major product of dietary fiber digestion, the short chain fatty acids (SCFAs), and that plays a role in the regulation of whole-body energy homeostasis and in intestinal immunity. In omnivorous mammals, the short chain fatty acids acetate, propionate and butyrate are produced primarily by the gut microbiome that metabolizes dietary fibers. SCFAs serve as a source of energy but also act as signaling molecules. That G protein-coupled receptor is probably coupled to the pertussis toxin-sensitive, G(i/o)-alpha family of G proteins but also to the Gq family (PubMed:23589301). Its activation results in the formation of inositol 1,4,5-trisphosphate, the mobilization of intracellular calcium, the phosphorylation of the MAPK3/ERK1 and MAPK1/ERK2 kinases and the inhibition of intracellular cAMP accumulation. May play a role in glucose homeostasis by regulating the secretion of GLP-1, in response to short-chain fatty acids accumulating in the intestine. May also regulate the production of LEP/Leptin, a hormone acting on the central nervous system to inhibit food intake. Finally, may also regulate whole-body energy homeostasis through adipogenesis regulating both differentiation and lipid storage of adipocytes. In parallel to its role in energy homeostasis, may also mediate the activation of the inflammatory and immune responses by SCFA in the intestine, regulating the rapid production of chemokines and cytokines. May also play a role in the resolution of the inflammatory response and control chemotaxis in neutrophils. In addition to SCFAs, may also be activated by the extracellular lectin FCN1 in a process leading to activation of monocytes and inducing the secretion of interleukin-8/IL-8 in response to the presence of microbes.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...