Terf2ip (NM_001013143) Rat Untagged Clone

CAT#: RN215114

Terf2ip (untagged ORF) - Rat telomeric repeat binding factor 2, interacting protein (Terf2ip), (10 ug)



  "NM_001013143" in other vectors (3)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms MGC105533
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215114 representing NM_001013143
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGAGGTAATGGATCTGGGTAAAGATCCCAATGGGCCCACCCACTCCTCCACTCTGTTTGTGAGAG
AAGACGGCAGCGCCATGTCGTTTTACGTGCGGCCCAGCTCGGCCAAGCGCCGGCTGTCAACGCTCATCCT
GCACGGCGGCGGCATCTTGTGTCGGGTGCAGAAGCCCGGGGCGGTGCTGCTAGCCCAGCCCGGGGAGGCG
CTGGCCGAGGCTTCGGGCGACTTCATCTCCACGCAGTACATCCTAGACTGCGTGGAGCGCAACGAGAAGC
TGGAACTGGAGGCCTATCGGCTGGGCCTGACGGAGCAGGCGTCCGACCCTAAGCCCGGGGCTTCTGCGGA
GGGCTCCACGGAACCCGAGCCTCAGCCCCTGACCGGGCGCATTGCCTACACTGACGCAGACGATGTGGCC
ATCCTAACCTACGTAAAGGAAAATGCCCGTTCGCCCAGCTCAGTCACAGGCAATGCCTTGTGGAAAGCGA
TGGAGAAGAGCTCGCTCACGCAGCACTCCTGGCAGTCGCTCAAGGACCGCTACCTCAAGCACCTGCAGGG
CCAGGAGCACAAGTACCTGCTCGGGAACGCTCCGGTCAGCCCGTCCTCCCAGAAGCTCAAACGGAAGGCG
GAGCAGGACCCGGAGGCTGCGGATAGCGGGGAGCCACAGAACAAGAGGACGCCAGACTTGCCTGAAGAGG
AGTGTGTGAAGGGGGAGACCAAGGAGAATGGAGAGGCAGACAACAAGCTATTTGAGGAAGCTACTCCGGA
GTTGGGGGAAGCCGTGGTGGATGAGAGCCCTGACTTTGAAATACACATAACCATGTGTGATGGTGATCCA
CCCACACCTGAGGAAGATTCAGAAACACAGCCAGACGAGGAGGAAGAGGAACCAAAAGTTTCTACACAAG
AAGTGGGAACTGCCATTAAGATCATCCGGCAGCTAATGGAAAAGTTTAACTTGGATCTCTCAACAGTTAC
ACAGGCCTTGCTGAAAAACAGTGGTGAACTGGAGGCCACTTCCTCTTTCTTAGAGTCTGGACGGAGACCT
GATGGTTTCCCAATTTGGTGCCGACAAGATGACTTAGATTTGCAAAAGGACGATGATGACACTAGAAATG
CACTGGTCAAAAAATATGGAGCTCAGAATGTTGCTCGGAGGATCGAATTTCGAAAGAAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001013143
Insert Size 1182 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001013143.1, NP_001013161.1
RefSeq Size 2165 bp
RefSeq ORF 1182 bp
Locus ID 307861
UniProt ID Q5EAN7
Gene Summary Acts both as a regulator of telomere function and as a transcription regulator. Involved in the regulation of telomere length and protection as a component of the shelterin complex (telosome). In contrast to other components of the shelterin complex, it is dispensible for telomere capping and does not participate in the protection of telomeres against non-homologous end-joining (NHEJ)-mediated repair. Instead, it is required to negatively regulate telomere recombination and is essential for repressing homology-directed repair (HDR), which can affect telomere length. Does not bind DNA directly: recruited to telomeric double-stranded 5'-TTAGGG-3' repeats via its interaction with TERF2. Independently of its function in telomeres, also acts as a transcription regulator: recruited to extratelomeric 5'-TTAGGG-3' sites via its association with TERF2 or other factors, and regulates gene expression. When cytoplasmic, associates with the I-kappa-B-kinase (IKK) complex and acts as a regulator of the NF-kappa-B signaling by promoting IKK-mediated phosphorylation of RELA/p65, leading to activate expression of NF-kappa-B target genes (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...