Cebpb (NM_001301715) Rat Untagged Clone

CAT#: RN216223

Cebpb (untagged) - Rat CCAAT/enhancer binding protein (C/EBP), beta (Cebpb), transcript variant 1



  "NM_001301715" in other vectors (1)

CNY 2760.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Il6dbp; NF-IL6; TCF5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN216223 representing NM_001301715
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAGTGGCCAACTTCTACTACGAGCCCGACTGCCTGGCCTACGGGGCCAAGGCGGCCCGCGCCGCGC
CGCGCGCCCCCGCCGCCGAGCCGGCCATCGGCGAGCACGAGCGCGCCATCGACTTCAGCCCCTACCTGGA
GCCGCTCGCGCCCGCCGCCGCGGACTTCGCCGCGCCCGCGCCCGCGCACCACGACTTCCTTTCCGACCTC
TTCGCCGACGACTACGGCGCCAAGCCGAGCAAGAAGCCGTCCGACTACGGTTACGTGAGCCTCGGCCGCG
CGGGCGCCAAGGCCGCACCGCCCGCCTGCTTCCCGCCGCCGCCTCCCGCCGCACTCAAGGCCGAGCCGGG
CTTCGAACCCGCGGACTGCAAGCGCGCGGACGACGCGCCCGCCATGGCGGCCGGCTTCCCGTTCGCCCTG
CGCGCCTACCTGGGCTACCAGGCGACGCCGAGCGGCAGCAGCGGCAGCCTGTCCACGTCGTCGTCGTCCA
GCCCGCCCGGGACGCCGAGCCCCGCCGACGCCAAGGCCGCGCCCGCCGCCTGCTTCGCGGGGCCGCCGGC
CGCGCCCGCCAAGGCCAAGGCCAAGAAGGCGGTGGACAAGCTGAGCGACGAGTACAAGATGCGGCGCGAG
CGCAACAACATCGCGGTGCGCAAGAGCCGCGACAAGGCCAAGATGCGCAACCTGGAGACGCAGCACAAGG
TGCTGGAGCTGACGGCGGAGAACGAGCGGCTGCAGAAGAAGGTGGAGCAGCTGTCGCGAGAGCTCAGCAC
GCTGCGGAACTTGTTCAAGCAGCTGCCCGAGCCGCTGCTGGCCTCGGCGGGTCACTGCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001301715
Insert Size 831 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001301715.1, NP_001288644.1
RefSeq Size 1475 bp
RefSeq ORF 831 bp
Locus ID 24253
UniProt ID P21272
Gene Summary This intronless gene encodes a member of the transcription factor family whose members contain a basic leucine-zipper domain. The encoded protein functions as a homodimer but can also form heterodimers with CCAAT/enhancer-binding proteins alpha, delta, and gamma. The encoded protein plays important roles in several cellular processes and in various diseases, including regulating cell proliferation, differentiation, apoptosis and neuroinflammation, and being involved in brain injury and inflammatory progression. The use of alternative in-frame AUG start codons results in multiple protein isoforms, each with different cellular localizations and distinct biological functions. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (1) encodes multiple isoforms through the use of alternative translation initiation codons. The isoform [LAP2, also known as LAP (liver activating protein), p34 or CRP2 (c/EBP-related protein 2)] represented in this RefSeq results from translation initiation at a downstream AUG start codon. Isoform LAP2 has a shorter N-terminus, compared to isoform LAP1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...