Selenov (NM_001166396) Rat Untagged Clone

CAT#: RN216369

Selv (untagged) - Rat selenoprotein V (Selv)



  "NM_001166396" in other vectors (1)

CNY 3140.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms RGD1562943; Selv
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN216369 representing NM_001166396
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAATAACAAGGCGCGGAACCCCGCTCCCTCTTCAGTCCGGGCAAACACCCCGTCCCGGACACCCACTC
CCGTCCGAACCGCGACCCCAGTCAGGGCCTCGACCCCGGCGCACAACCGGTCTCCGGTCCGAACATCCAT
CCGGGTCCGGACTCCTGCTAACCCTGTTCCAATTCGGTTCCCTACTCCAGCCCCAGCCCCTGCCCCAACT
CCAACCCCAGCCCCAACTCCAGCCCCAGTCCCGGCCGCAGCACCGGTGCGGACTCCAGCACCAGTCCGGG
CCTCCATTCAAGGTCGGAGCTTTCCCACGATCTCTCCAGTGAGATTCTTACGGAACTTGGCCTTGCCCGC
GGCACAGCCCCTTTCTTCCGGGGGTGCTGGCTCTCTCTCAAAGGATCTCACGCTCGCTCAAAAGCAGAAG
CCCTCGATCCACAGCCTAGCGGAGGCCATCCAGGGGCCCTTTCCAGTGCTCACTCCCTCGGCCTCCTCGG
AGACCCACGGCTCCATACCGGACCCCGCCCCTCCCACTGACTCCTTGGCTTCCACTGCCATGGCCTCCAG
TACCTTGGACCCCATTCCGGGCCCCAAACCTACACTAGAGTTCTTGGCCTCCCCGCTGAAGGAAACCCCT
GATTTGGGTAAGCTCTCCACAATTTCCCCAGCACAGAACTTCGTTTCCACTAAGGAGGTCCCCTCCACCA
GCGAGGACGTCCCAACGGCCAACAGAATCTTGATCCGTGTGATGTACTGTGGCCTCTGAAGCTATGGCCT
TCGGTACATTCTACTGAAAAAGACCCTGGAGCATCAATTTCCAAACCTTCTGGAGTTTGAGGAGGAAAGA
GCTACCCAGGTTACAGGGGAGTTTGAAGTGTTTGTGGATGGGAAATTGATCCATTCCAAGAAGAAAGGCG
ATGGCTTTGTGGATGAGACTAGTCTGAAGAAACTTGTGGGTGCTATTGATGAAGAGATCAAGAAAAGGTA
G


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001166396
Insert Size 981 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001166396.1, NP_001159868.1
RefSeq Size 1228 bp
RefSeq ORF 981 bp
Locus ID 499113
Gene Summary This gene encodes a selenoprotein containing a selenocysteine (Sec) residue, which is encoded by the UGA codon that normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, the Sec insertion sequence (SECIS) element, which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. This protein is specifically expressed in the testis. It belongs to the SelWTH family, which possesses a thioredoxin-like fold and a conserved CxxU (C is cysteine, U is Sec) motif, suggesting a redox function for this gene. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2017]
Transcript Variant: This variant (1) represents the predominant transcript, and encodes a selenoprotein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript and the encoded protein are supported by orthologous mouse data. ##RefSeq-Attributes-START## NMD candidate :: translation inferred from conservation protein contains selenocysteine :: inferred from conservation ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...