Selenop (NM_001083911) Rat Untagged Clone

CAT#: RN216536

Sepp1 (untagged) - Rat selenoprotein P, plasma, 1 (Sepp1), transcript variant 2



  "NM_001083911" in other vectors (1)

CNY 3710.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Sepp1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN216536 representing NM_001083911
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTGGAGAAGCCTAGGGCTTGCCCTGGCTCTCTGTCTCCTCCCCTATGGAGGAGCAGAGAGCCAAGGCC
AAAGCCCTGCTTGTAAGCAAGCTCCACCCTGGAACATAGGAGATCAAAATCCAATGCTAAACTCCGAGGG
CACAGTGACAGTGGTTGCTCTTCTTCAAGCCAGCTGATACCTGTGCCTTCTGCAGGCATCCAGATTGGAA
GACCTGCGAATAAAACTAGAGAACCAAGGATATTTTAACATCTCCTATATTGTTGTTAATCATCAAGGAT
CTCCTTCCCAATTAAAACATGCACATCTTAAAAAGCAGGTGTCAGATCACATTGCTGTTTACAGACAAGA
TGAACATCAAACAGATGTCTGGACACTCTTAAATGGAAACAAAGATGACTTCCTCATATATGACAGATGT
GGCCGTCTTGTGTATCACCTTGGTTTGCCCTACTCCTTCCTCACTTTCCCGTATGTTGAAGAAGCCATCA
AGATCGCTTACTGTGAGAAGAGGTGTGGAAACTGCTCTTTCACGAGTCTTGAAGATGAAGCCTTCTGTAA
AAACGTGTCCTCGGCTACTGCAAGTAAAACCACAGAGCCCTCAGAGGAGCATAACCACCACAAGCACCAT
GACAAACATGGGCATGAGCATCTTGGGAGCAGTAAGCCTTCAGAGAATCAGCAACCAGGGGCATTAGATG
TTGAGACAAGTCTTCCTCCTTCAGGCTTGCACCACCACCACCACCACCATAAGCACAAGGGCCAGCACAG
GCAGGGTCACTTAGAGAGCTGAGACATGGGGGCAAGTGAAGGCTTGCAACTTTCACTTGCCCAGAGGAAG
CTCTGACGAAGGGGATGCATAAACCAGCTCCTGTGTAAGTTATCTGAGGAGTCTGGGGCAGCTACCAGTA
GCTGCTGCTGCCACTGCCGACACCTCATATTTGAGAAGTCAGGATCTGCAATCACTTGACAGTGTGCCGA
AAACCTCCCATCCTTGTGTAGCTGACAGGGGCTTTTCGCGGAGGAGAAAGTCATTGAATCCTGTCAATGT
AGATCACCTCCAGCTGCCTGACACAGTCAGCATGTAAGCCCCACAGAAGCCAGCCCCAACTGAAGCTGAA
ATAATAAGACCAAGAAGTGAAAATGAAATTTGAACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001083911
Insert Size 1158 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001083911.1, NP_001077380.1
RefSeq Size 2115 bp
RefSeq ORF 1158 bp
Locus ID 29360
UniProt ID P25236
Gene Summary This gene encodes a selenoprotein that is predominantly expressed in the liver and secreted into the plasma. This selenoprotein is unique in that it contains multiple selenocysteine (Sec) residues per polypeptide (10 in rat), and accounts for most of the selenium in plasma. It has been implicated as an extracellular antioxidant, and in the transport of selenium to extra-hepatic tissues via apolipoprotein E receptor-2 (apoER2). Mice lacking this gene exhibit neurological dysfunction, suggesting its importance in normal brain function. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. The mRNA for this selenoprotein contains two SECIS elements. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2017]
Transcript Variant: This variant (2, also known as Sepp1b) uses an alternate 5' non-coding exon, hence has a different 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein containing 10 selenocysteine residues.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...