CISD2 (BC032300) Human Untagged Clone

CAT#: SC101633

CISD2 (untagged)-Homo sapiens, Similar to RIKEN cDNA 1500009M05 gene, clone MGC:40370 IMAGE:5105935, complete cds



CNY 4016.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
CISD2 mouse monoclonal antibody,clone OTI4D12
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CDGSH iron sulfur domain 2; endoplasmic reticulum intermembrane small protein; ERIS; Miner1; mitoNEET related 1; WFS2; ZCD2; zinc finger, CDGSH-type domain 2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for BC032300, the custom clone sequence may differ by one or more nucleotides


ATGGTGCTGGAGAGCGTGGCCCGTATCGTGAAGGTGCAGCTCCCTGCATATCTGAAGCGGCTCCCAGTCC
CTGAAAGCATTACCGGGTTCGCTAGGCTCACAGTTTCAGAATGGCTTCGGTTATTGCCTTTCCTTGGTGT
ACTCGCACTTCTTGGCTACCTTGCAGTTCGTCCATTCCTCCCGAAGAAGAAACAACAGAAGGATAGCTTG
ATTAATCTTAAAATACAAAAGGAAAATCCGAAAGTAGTGAATGAAATAAACATTGAAGATTTGTGTCTTA
CTAAAGCAGCTTATTGTAGGTGTTGGCGTTCTAAAACGTTTCCTGCCTGCGATGGTTCACATAATAAACA
CAATGAATTGACAGGAGATAATGTGGGTCCACTAATACTGAAGAAGAAAGAAGTATAA


>OriGene 5' read for BC032300 unedited
GCACGAGGCCGAGGCCGCCAGTGCCCGCCGGCCGCTTCCGCTCCCGGCGCAGGCGCTGCA
GCTTGGCCAGAGCGGAGGGGGCTCGGGAGAGGAGTGGACGCCGCTGGCCAGGATGGTGCT
GGAGAGCGTGGCCCGTATCGTGAAGGTGCAGCTCCCTGCATATCTGAAGCGGCTCCCAGT
CCCTGAAAGCATTACCGGGTTCGCTAGGCTCACAGTTTCAGAATGGCTTCGGTTATTGCC
TTTCCTTGGTGTACTCGCACTTCTTGGCTACCTTGCAGTTCGTCCATTCCTCCCGAAGAA
GAAACAACAGAAGGATAGCTTGATTAATCTTAAAATACAAAAGGAAAATCCGAAAGTAGT
GAATGAAATAAACATTGAAGATTTGTGTCTTACTAAAGCAGCTTATTGTAGGTGTTGGCG
TTCTAAAACGTTTCCTGCCTGCGATGGTTCACATAATAAACACAATGAATTGACAGGAGA
TAATGTGGGTCCACTAATACTGAAGAAGAAAGAAGTATAATAATAATAACAATATTTTCT
CATTCTTTGTGTATAGAAAATTTTAAAATGGTGGTCTTAATTATTACTACTGGTTGAACA
ATTATTTCTTCCAATTTATTTTCTTCCTGCACTAC
Restriction Sites NotI-NotI     
ACCN BC032300
Insert Size 2500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC032300.1, AAH32300.1
RefSeq Size 1617 bp
RefSeq ORF 1617 bp
Locus ID 493856
Protein Families Transmembrane
Gene Summary The protein encoded by this gene is a zinc finger protein that localizes to the endoplasmic reticulum. The encoded protein binds an iron/sulfur cluster and may be involved in calcium homeostasis. Defects in this gene are a cause of Wolfram syndrome 2. [provided by RefSeq, Mar 2011]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...