PRKAR2B (NM_002736) Human Untagged Clone

CAT#: SC125501

PRKAR2B (untagged)-Human protein kinase, cAMP-dependent, regulatory, type II, beta (PRKAR2B)



  "NM_002736" in other vectors (4)

CNY 5488.00


货期*
现货

规格
    • 10 ug

Cited in 3 publications.

Product images

推荐一起购买 (3)
Rabbit polyclonal PKA-R2beta (Ab-113) antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PRKAR2; RII-BETA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC125501 GCGATCGCCATGAGCATCGAGATCCCGGCGGGACTGACGGAGCTGCTGCAGGGCTTCACGGTGGAGGTGC
TGAGGCACCAGCCCGCGGACCTGCTGGAGTTCGCTCTGCAGCACTTCACCCGCCTGCAGCAGGAGAACGA
GCGCAAAGGCACCGCGCGCTTCTGCCATGAGGGCAGGACCTGGGGGGACCTGGGCGCCGCTGCCGGGGGC
GGCACCCCCAGCAAGGGGGTCAACTTCGCCGAGGAGCCCATGCAGTCCGACTCCGAGGACGGGGAGGAGG
AGGAGGCGGCGCCCGCGGACGCAGGGGCGTTCAATGCTCCAGTAATAAACCGATTCACAAGGCGTGCCTC
AGTATGTGCAGAAGCTTATAATCCTGATGAAGAAGAAGATGATGCAGAGTCCAGGATTATACATCCAAAA
ACTGATGATCAAAGAAATAGGTTGCAAGAGGCTTGCAAAGACATCCTGCTGTTTAAGAATCTGGATCCGG
AGCAGATGTCTCAAGTATTAGATGCCATGTTTGAAAAATTGGTCAAAGATGGGGAGCATGTAATTGATCA
AGGTGACGATGGTGACAACTTTTATGTAATTGATAGAGGCACATTTGATATTTATGTGAAATGTGATGGT
GTTGGAAGATGTGTTGGTAACTATGATAATCGTGGGAGTTTCGGCGAACTGGCCTTAATGTACAATACAC
CCAGAGCAGCTACAATCACTGCTACCTCTCCTGGTGCTCTGTGGGGTTTGGACAGGGTAACCTTCAGGAG
AATAATTGTGAAAAACAATGCCAAAAAGAGAAAAATGTATGAAAGCTTTATTGAGTCACTGCCATTCCTT
AAATCTTTGGAGTTTTCTGAACGCCTGAAAGTAGTAGATGTGATAGGCACCAAAGTATACAACGATGGAG
AACAAATCATTGCTCAGGGAGATTCGGCTGATTCTTTTTTCATTGTAGAATCTGGAGAAGTGAAAATTAC
TATGAAAAGAAAGGGTAAATCAGAAGTGGAAGAGAATGGTGCAGTAGAAATCGCTCGATGCTCGCGGGGA
CAGTACTTTGGAGAGCTTGCCCTGGTAACTAACAAACCTCGAGCAGCTTCTGCCCACGCCATTGGGACTG
TCAAATGTTTAGCAATGGATGTGCAAGCATTTGAAAGGCTTCTGGGACCTTGCATGGAAATTATGAAAAG
GAACATCGCTACCTATGAAGAACAGTTAGTTGCCCTGTTTGGAACGAACATGGATATTGTTGAACCCACT
GCATGAACGCGT
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites NotI-NotI     
ACCN NM_002736
Insert Size 3520 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002736.2, NP_002727.2
RefSeq Size 3678 bp
RefSeq ORF 1257 bp
Locus ID 5577
UniProt ID P31323
Domains cNMP, RIIa
Protein Families Druggable Genome
Protein Pathways Apoptosis, Insulin signaling pathway
Gene Summary cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. This subunit has been shown to interact with and suppress the transcriptional activity of the cAMP responsive element binding protein 1 (CREB1) in activated T cells. Knockout studies in mice suggest that this subunit may play an important role in regulating energy balance and adiposity. The studies also suggest that this subunit may mediate the gene induction and cataleptic behavior induced by haloperidol. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (3)

Other Versions

Customer Reviews 
Loading...