Anoctamin 7 (ANO7) (NM_001001666) Human Untagged Clone
CAT#: SC300251
ANO7 (untagged)-Human anoctamin 7 (ANO7), transcript variant NGEP-S
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | D-TMPP; DTMPP; IPCA-5; IPCA5; NGEP; PCANAP5; PCANAP5L; TMEM16G |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001001666, the custom clone sequence may differ by one or more nucleotides
ATGCGAATGGCTGCCACTGCCTGGGCGGGGCTCCAAGGGCCACCCCTCCCCACCCTCTGT CCCGCAGTGAGGACGGGACTCTACTGCCGAGACCAGGCTCACGCTGAGAGGTGGGCCATG ACCTCCGAGACCTCTTCCGGAAGCCACTGTGCCAGGAGCAGGATGCTGCGGCGACGGGCC CAGGAAGAGGACAGCACCGTCCTGATCGATGTGAGCCCCCCTGAGGCAGAGAAGAGGGGC TCTTACGGGAGCACAGCCCACGCCTCGGAGCCAGGTGGACAGCAAGCGGCCGCCTGCAGA GCTGGGAGTCCTGCCAAGCCCCGGATCGACTTCGTCCTCGTTTGGGAGGAGGACCTGAAG CTAGACAGGCAGCAGGACAGTGCCGCCCGGGACAGAACAGACATGCACAGGACCTGGCGG GAGACTTTTCTGGATAATCTTCGTGCGGCTGGGCTGTGTGTAGACCAGGTACGTGGAGGC TGTCATGGGCAGGGCCCTAGGCCCTGCATCCACTCAGTGACCCATGACCTTGCCGCATGA |
Restriction Sites | Please inquire |
ACCN | NM_001001666 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001001666.1, NP_001001666.1 |
RefSeq Size | 917 bp |
RefSeq ORF | 540 bp |
Locus ID | 50636 |
UniProt ID | Q6IWH7 |
Protein Families | Transmembrane |
Gene Summary | This prostate-specific gene encodes a cytoplasmic protein, as well as a polytopic membrane protein which may serve as a target in prostate cancer diagnosis and immunotherapy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (2, also known as NGEP-S) lacks several exons and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR compared to variant 1. The encoded isoform (2, also known as isoform NGEP short) is shorter and contains a distinct C-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214843 | ANO7 (Myc-DDK-tagged)-Human anoctamin 7 (ANO7), transcript variant NGEP-S |
CNY 3990.00 |
|
RC214843L3 | Lenti-ORF clone of ANO7 (Myc-DDK-tagged)-Human anoctamin 7 (ANO7), transcript variant NGEP-S |
CNY 5890.00 |
|
RC214843L4 | Lenti-ORF clone of ANO7 (mGFP-tagged)-Human anoctamin 7 (ANO7), transcript variant NGEP-S |
CNY 5890.00 |
|
RG214843 | ANO7 (tGFP-tagged) - Human anoctamin 7 (ANO7), transcript variant NGEP-S |
CNY 4370.00 |
其它Anoctamin 7产品