GPM6B (NM_001001994) Human Untagged Clone
CAT#: SC300380
GPM6B (untagged)-Human glycoprotein M6B (GPM6B), transcript variant 4
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | M6B |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC300380 representing NM_001001994.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGCTGCTTTGAATGCTGCATCAAGTGTCTGGGAGGAGTCCCCTACGCCTCCCTGGTGGCCACCATC CTCTGCTTCTCCGGGGTGGCCTTATTCTGCGGCTGTGGGCATGTGGCTCTCGCAGGCACCGTGGCGATT CTTGAGCAACACTTCTCCACCAACGCCAGTGACCATGCCTTGCTGAGCGAGGTGATACAACTGATGCAG TATGTCATCTATGGAATTGCGTCCTTTTTCTTCTTGTATGGGATCATTCTGTTGGCAGAAGGCTTTTAC ACCACAAGTGCAGTGAAAGAACTGCACGGTGAGTTTAAAACAACCGCTTGTGGCCGATGCATCAGTGGA ATGTTCGTTTTCCTCACCTATGTGCTTGGAGTGGCCTGGCTGGGTGTGTTTGGTTTCTCAGCGGTGCCC GTGTTTATGTTCTACAACATATGGTCAACTTGTGAAGTCATCAAGTCACCGCAGACCAACGGGACCACG GGTGTGGAGCAGATCTGTGTGGATATCCGACAATACGGTATCATTCCTTGGAATGCTTTCCCCGGAAAA ATATGTGGCTCTGCCCTGGAGAACATCTGCAACACAAACGAGTTCTACATGTCCTATCACCTGTTCATT GTGGCCTGTGCAGGAGCTGGTGCCACCGTCATTGCCCTGCTGATCTACATGATGGCTACTACATATAAC TATGCGGTTTTGAAGTTTAAGAGTCGGGAAGATTGCTGCACTAAATTCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001001994 |
Insert Size | 741 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001001994.2 |
RefSeq Size | 4699 bp |
RefSeq ORF | 741 bp |
Locus ID | 2824 |
UniProt ID | Q13491 |
Protein Families | Transmembrane |
MW | 26.8 kDa |
Gene Summary | This gene encodes a membrane glycoprotein that belongs to the proteolipid protein family. Proteolipid protein family members are expressed in most brain regions and are thought to be involved in cellular housekeeping functions such as membrane trafficking and cell-to-cell communication. This protein may also be involved in osteoblast differentiation. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are located on chromosomes Y and 22. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (4) uses an alternate exon structure in the 5' UTR and 5' coding region and uses an alternate splice site in the 3' terminal exon compared to variant 1. The encoded protein (isoform 4) is shorter and has distinct N- and C-termini, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222760 | GPM6B (Myc-DDK-tagged)-Human glycoprotein M6B (GPM6B), transcript variant 4 |
CNY 2400.00 |
|
RC222760L3 | Lenti ORF clone of Human glycoprotein M6B (GPM6B), transcript variant 4, Myc-DDK-tagged |
CNY 5890.00 |
|
RC222760L4 | Lenti ORF clone of Human glycoprotein M6B (GPM6B), transcript variant 4, mGFP tagged |
CNY 5890.00 |
|
RG222760 | GPM6B (tGFP-tagged) - Human glycoprotein M6B (GPM6B), transcript variant 4 |
CNY 4370.00 |