UFSP1 (NM_001015072) Human Untagged Clone
CAT#: SC301999
UFSP1 (untagged)-Human UFM1-specific peptidase 1 (non-functional) (UFSP1)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | UFSP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC301999 representing NM_001015072.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGCGACAAGCCCCCCGGCTTCCGGGGCTCCCGGGACTGGATCGGCTGCGTGGAGGCCAGCCTCTGC CTCGCTCACTTCGGAGGGCCCCAGGGACGCCTCTGCCACGTACCCCGGGGAGTGGGGCTGCACGGGGAG CTGGAGAGGCTTTACTCGCACTTCGCAGGGGGTGGGGGCCCAGTCATGGTTGGGGGGGACGCAGATGCC AGGTCCAAGGCCTTGCTGGGAGTCTGCGTAGGGTCAGGCACGGAAGCCTATGTCCTGGTATTGGACCCT CACTACTGGGGCACTCCAAAAAGCCCCAGTGAACTACAGGCTGCTGGGTGGGTGGGCTGGCAAGAGGTG AGTGCAGCCTTTGACCCCAACTCCTTCTACAACCTGTGCTTGACCAGCCTTAGCTCCCAACAGCAGCAG CGCACCTTGGACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001015072 |
Insert Size | 429 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001015072.3 |
RefSeq Size | 1016 bp |
RefSeq ORF | 429 bp |
Locus ID | 402682 |
UniProt ID | Q6NVU6 |
MW | 15.1 kDa |
Gene Summary | This gene encodes a protein that is similar to other Ufm1-specific proteases. Studies in mouse determined that Ufsp1 releases Ufm1 (ubiquitin-fold modifier 1) from its bound conjugated complexes which also makes it into an active form. Because the human UFSP1 protein is shorter on the N-terminus and lacks a conserved Cys active site, it is predicted to be non-functional.[provided by RefSeq, Nov 2009] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209897 | UFSP1 (Myc-DDK-tagged)-Human UFM1-specific peptidase 1 (non-functional) (UFSP1) |
CNY 1200.00 |
|
RC209897L1 | Lenti ORF clone of Human UFM1-specific peptidase 1 (non-functional) (UFSP1), Myc-DDK-tagged |
CNY 3600.00 |
|
RC209897L2 | Lenti ORF clone of Human UFM1-specific peptidase 1 (non-functional) (UFSP1), mGFP tagged |
CNY 5890.00 |
|
RC209897L3 | Lenti ORF clone of Human UFM1-specific peptidase 1 (non-functional) (UFSP1), Myc-DDK-tagged |
CNY 5890.00 |
|
RC209897L4 | Lenti ORF clone of Human UFM1-specific peptidase 1 (non-functional) (UFSP1), mGFP tagged |
CNY 5890.00 |
|
RG209897 | UFSP1 (tGFP-tagged) - Human UFM1-specific peptidase 1 (non-functional) (UFSP1) |
CNY 2800.00 |