BRCC36 (BRCC3) (NM_001018055) Human Untagged Clone
CAT#: SC302145
BRCC3 (untagged)-Human BRCA1/BRCA2-containing complex, subunit 3 (BRCC3), transcript variant 2
CNY 2400.00
CNY 6270.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BRCC36; C6.1A; CXorf53 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001018055 edited
ATGGCGGTGCAGGTGGTGCAGGCGGTGCAGGCGGTTCATCTCGAGTCTGACGCTTTCCTC GTTTGTCTCAACCACGCTCTGAGCACAGAGAAGGAGGAAGTAATGGGGCTGTGCATAGGG GAGTTGAACGATGATACAAGGAGTGACTCCAAATTTGCATATACTGGAACTGAAATGCGC ACAGTTGCTGAAAAGGTTGATGCCGTCAGAATTGTTCACATTCATTCTGTCATCATCTTA CGACGTTCTGATAAGAGGAAGGACCGAGTAGAAATTTCTCCAGAGCAGCTGTCTGCAGCT TCAACAGAGGCAGAGAGGTTGGCTGAACTGACAGGCCGCCCCATGAGAGTTGTGGGCTGG TATCATTCCCATCCTCATATAACTGTTTGGCCTTCACATGTTGATGTTCGCACACAAGCC ATGTACCAGATGATGGATCAAGGCTTTGTAGGACTTATTTTTTCCTGTTTCATAGAAGAT AAGAACACAAAGACTGGCCGGGTACTCTACACTTGCTTCCAATCCATACAGGCCCAAAAG AGTTCAGAGTATGAGAGAATCGAAATCCCAATCCATATTGTACCTCATGTCACTATCGGG AAAGTGTGCCTTGAATCAGCAGTAGAGCTGCCCAAGATCCTGTGCCAGGAGGAGCAGGAT GCGTATAGGAGGATCCACAGCCTTACACATCTGGACTCAGTAACCAAGATCCATAATGGC TCAGTGTTTACCAAGAATCTGTGCAGTCAGATGTCGGCAGTCAGCGGGCCTCTCCTACAG TGGTTGGAGGACAGACTGGAGCAAAACCAACAGCATTTGCAGGAATTACAACAAGAAAAG GAAGAGCTTATGCAAGAACTTTCTTCTCTAGAATAA |
Restriction Sites | NotI-NotI |
ACCN | NM_001018055 |
Insert Size | 2800 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001018055.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001018055.1, NP_001018065.1 |
RefSeq Size | 2839 bp |
RefSeq ORF | 876 bp |
Locus ID | 79184 |
UniProt ID | P46736 |
Protein Families | Druggable Genome, Protease |
Gene Summary | This gene encodes a subunit of the BRCA1-BRCA2-containing complex (BRCC), which is an E3 ubiquitin ligase. This complex plays a role in the DNA damage response, where it is responsible for the stable accumulation of BRCA1 at DNA break sites. The component encoded by this gene can specifically cleave Lys 63-linked polyubiquitin chains, and it regulates the abundance of these polyubiquitin chains in chromatin. The loss of this gene results in abnormal angiogenesis and is associated with syndromic moyamoya, a cerebrovascular angiopathy. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 5. [provided by RefSeq, Jun 2011] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224289 | BRCC3 (Myc-DDK-tagged)-Human BRCA1/BRCA2-containing complex, subunit 3 (BRCC3), transcript variant 2 |
CNY 2400.00 |
|
RC224289L1 | Lenti ORF clone of Human BRCA1/BRCA2-containing complex, subunit 3 (BRCC3), transcript variant 2, Myc-DDK-tagged |
CNY 4800.00 |
|
RC224289L2 | Lenti ORF clone of Human BRCA1/BRCA2-containing complex, subunit 3 (BRCC3), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RC224289L3 | Lenti ORF clone of Human BRCA1/BRCA2-containing complex, subunit 3 (BRCC3), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC224289L4 | Lenti ORF clone of Human BRCA1/BRCA2-containing complex, subunit 3 (BRCC3), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG224289 | BRCC3 (tGFP-tagged) - Human BRCA1/BRCA2-containing complex, subunit 3 (BRCC3), transcript variant 2 |
CNY 4370.00 |