IQ motif containing B1 (IQCB1) (NM_001023571) Human Untagged Clone
CAT＃: SC302222
IQCB1 (untagged)-Human IQ motif containing B1 (IQCB1), transcript variant 3
CNY 7220.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | NPHP5; PIQ; SLSN5 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001023571, the custom clone sequence may differ by one or more nucleotides
ATGAAGCCAACAGGTACAGACCCAAGGATCTTATCTATAGCTGCTGAAGTTGCAAAAAGC CCTGAGCAGAATGTCCCTGTTATACTGTTGAAGTTAAAAGAAATAATAAACATCACACCT TTAGGAAGCTCAGAGTTGAAGAAAATCAAACAAGATATATATTGTTATGATCTCATTCAA TATTGCCTCTTGGTCCTCAGTCAAGATTATTCTCGAATCCAGGGTGGTTGGACTACAATT TCCCAGCTTACACAGATATTAAGCCATTGCTGTGTGGGCTTGGAGCCAGGAGAAGATGCA GAGGAATTTTACAATGAATTACTTCCATCAGCTGCAGAAAATTTTCTAGTTTTGGGGAGA CAATTACAAACATGTTTTATCAATGCAGCTAAGGCTGAAGAAAAAGATGAATTACTACAC TTTTTCCAAATTGTGACTGATTCTCTCTTCTGGCTTTTGGGAGGCCATGTTGAACTTATT CAGAATGTACTACAAAGTGATCATTTCTTACATTTACTGCAAGCTGACAATGTCCAAATA GGATCTGCAGTCATGATGATGCTACAGAATATACTACAGATCAACAGATCCAAACGATCA AAGATGTTGCTGGAGATAAATAGGCAGAAGGAAGAAGAGGACCTCAAATTACAATTGCAA CTTCAAAGACAGAGAGCCATGAGACTTTCCCGAGAATTGCAGCTGAGTATGCTCGAAATA GTTCATCCAGGTCAGGTGGAGAAACACTATCGGGAAATGGAAGAGAAATCAGCACTGATT ATCCAGAAACATTGGAGAGGGTACAGGGAAAGGAAAAATTTTCACCAACAGAGGCAGTCT CTCATAGAGTATAAAGCAGCTGTCACACTTCAAAGAGCAGCGCTTAAATTCCTAGCGAAG TGCCGTAAGAAAAAGAAACTATTTGCTCCTTGGCGAGGACTCCAAGAACTCACTGATGCA CGCCGAGTTGAACTGAAGAAACGAGTGGATGACTATGTCAGAAGACATTTGGGCTCTCCA ATGTCAGATGTGGTCAGTAGGGAGCTCCATGCCCAAGCTCAAGAACGACTGCAACACTAC TTTATGGGCAGGGCCCTAGAAGAGCGAGCCCAGCAGCACAGAGAAGCTCTGATAGCACAG ATCAGCACCAACGTTGAACAGCTAATGAAGGCACCAAGTCTGAAGGAGGCAGAAGGGAAA GAACCTGAGCTCTTCCTAAGTAGATCCAGGCCTGTGGCAGCCAAGGCCAAGCAGGCCCAT CTCACAACCCTGAAGCACATACAAGCACCCTGGTGGAAGAAGCTTGGAGAAGAATCTGGA GATGAGATTGATGTTCCAAAGGATGAGCTTAGTATAGAATTAGAAAATTTATTCATTGGT GGAACCAAACCACCTTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001023571 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001023571.1, NP_001018865.1 |
| RefSeq Size | 1915 bp |
| RefSeq ORF | 1398 bp |
| Locus ID | 9657 |
| UniProt ID | Q15051 |
| Gene Summary | This gene encodes a nephrocystin protein that interacts with calmodulin and the retinitis pigmentosa GTPase regulator protein. The encoded protein has a central coiled-coil region and two calmodulin-binding IQ domains. It is localized to the primary cilia of renal epithelial cells and connecting cilia of photoreceptor cells. The protein is thought to play a role in ciliary function. Defects in this gene result in Senior-Loken syndrome type 5. Alternative splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 6. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (3) lacks alternate in-frame exons in the CDS, compared to variant 1. The encoded isoform (c) is shorter, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202388 | IQCB1 (Myc-DDK-tagged)-Human IQ motif containing B1 (IQCB1), transcript variant 3 |
CNY 3990.00 |
|
| RC202388L3 | Lenti-ORF clone of IQCB1 (Myc-DDK-tagged)-Human IQ motif containing B1 (IQCB1), transcript variant 3 |
CNY 5890.00 |
|
| RC202388L4 | Lenti-ORF clone of IQCB1 (mGFP-tagged)-Human IQ motif containing B1 (IQCB1), transcript variant 3 |
CNY 5890.00 |
|
| RG202388 | IQCB1 (tGFP-tagged) - Human IQ motif containing B1 (IQCB1), transcript variant 3 |
CNY 4370.00 |
|
| SC320753 | IQCB1 (untagged)-Human IQ motif containing B1 (IQCB1), transcript variant 3 |
CNY 3656.00 |
其它IQ motif containing B1产品
