S100 Calcium Binding Protein A13 (S100A13) (NM_001024211) Human Untagged Clone
CAT#: SC302233
S100A13 (untagged)-Human S100 calcium binding protein A13 (S100A13), transcript variant 3
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001024211, the custom clone sequence may differ by one or more nucleotides
ATGGCAGCAGAACCACTGACAGAGCTAGAGGAGTCCATTGAGACCGTGGTCACCACCTTC TTCACCTTTGCAAGGCAGGAGGGCCGGAAGGATAGCCTCAGCGTCAACGAGTTCAAAGAG CTGGTTACCCAGCAGTTGCCCCATCTGCTCAAGGATGTGGGCTCTCTTGATGAGAAGATG AAGAGCTTGGATGTGAATCAGGACTCGGAGCTCAAGTTCAATGAGTACTGGAGATTGATT GGGGAGCTGGCCAAGGAAATCAGGAAGAAGAAAGACCTGAAGATCAGGAAGAAGTAA |
Restriction Sites | Please inquire |
ACCN | NM_001024211 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001024211.1, NP_001019382.1 |
RefSeq Size | 667 bp |
RefSeq ORF | 297 bp |
Locus ID | 6284 |
UniProt ID | Q99584 |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein is widely expressed in various types of tissues with a high expression level in thyroid gland. In smooth muscle cells, this protein co-expresses with other family members in the nucleus and in stress fibers, suggesting diverse functions in signal transduction. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) has a distinct and shorter 5' UTR, as compared to variant 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211660 | S100A13 (Myc-DDK-tagged)-Human S100 calcium binding protein A13 (S100A13), transcript variant 3 |
CNY 1200.00 |
|
RC211660L3 | Lenti-ORF clone of S100A13 (Myc-DDK-tagged)-Human S100 calcium binding protein A13 (S100A13), transcript variant 3 |
CNY 5890.00 |
|
RC211660L4 | Lenti-ORF clone of S100A13 (mGFP-tagged)-Human S100 calcium binding protein A13 (S100A13), transcript variant 3 |
CNY 5890.00 |
|
RG211660 | S100A13 (tGFP-tagged) - Human S100 calcium binding protein A13 (S100A13), transcript variant 3 |
CNY 4370.00 |
其它S100 Calcium Binding Protein A13产品