BAALC (NM_001024372) Human Untagged Clone
CAT#: SC302242
BAALC (untagged)-Human brain and acute leukemia, cytoplasmic (BAALC), transcript variant 2
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001024372, the custom clone sequence may differ by one or more nucleotides
ATGGGCTGCGGCGGGAGCCGGGCGGATGCCATCGAGCCCCGCTACTACGAGAGCTGGACC CGGGAGACAGAATCCACCTGGCTCACCTACACCGACTCGGACGCGCCGCCCAGCGCCGCC GCCCCGGACAGCGGCCCCGAAGCGGGCGGCCTGCACTCGGGCTAA |
Restriction Sites | Please inquire |
ACCN | NM_001024372 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001024372.1, NP_001019543.1 |
RefSeq Size | 2692 bp |
RefSeq ORF | 165 bp |
Locus ID | 79870 |
UniProt ID | Q8WXS3 |
Gene Summary | This gene was identified by gene expression studies in patients with acute myeloid leukemia (AML). The gene is conserved among mammals and is not found in lower organisms. Tissues that express this gene develop from the neuroectoderm. Multiple alternatively spliced transcript variants that encode different proteins have been described for this gene; however, some of the transcript variants are found only in AML cell lines. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus when compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212819 | BAALC (Myc-DDK-tagged)-Human brain and acute leukemia, cytoplasmic (BAALC), transcript variant 2 |
CNY 3990.00 |
|
RC212819L3 | Lenti-ORF clone of BAALC (Myc-DDK-tagged)-Human brain and acute leukemia, cytoplasmic (BAALC), transcript variant 2 |
CNY 5890.00 |
|
RC212819L4 | Lenti-ORF clone of BAALC (mGFP-tagged)-Human brain and acute leukemia, cytoplasmic (BAALC), transcript variant 2 |
CNY 5890.00 |
|
RG212819 | BAALC (tGFP-tagged) - Human brain and acute leukemia, cytoplasmic (BAALC), transcript variant 2 |
CNY 4370.00 |