ARPC4 (NM_001024960) Human Untagged Clone

CAT#: SC302330

ARPC4 (untagged)-Human actin related protein 2/3 complex, subunit 4, 20kDa (ARPC4), transcript variant 3



  "NM_001024960" in other vectors (4)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-ARPC4 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARC20; P20-ARC
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001024960, the custom clone sequence may differ by one or more nucleotides
ATGCGCTTCATGATGATGCGAGCAGAGAACTTCTTTATCCTTCGAAGGAAGCCTGTGGAG
GGGTATGATATCAGCTTTCTGATCACCAACTTCCACACAGAGCAGATGTACAAACACAAG
TTGGTGGACTTTGTGATCCACTTCATGGAGGAGATTGACAAGGAGATCAGTGAGATGAAG
CTGTCAGTCAATGCCCGTGCCCGCATTGTGGCTGAAGAGTTCCTTAAGAATTTTTAA
Restriction Sites Please inquire     
ACCN NM_001024960
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001024960.1, NP_001020131.1
RefSeq Size 1412 bp
RefSeq ORF 237 bp
Locus ID 10093
UniProt ID P59998
Protein Pathways Fc gamma R-mediated phagocytosis, Pathogenic Escherichia coli infection, Regulation of actin cytoskeleton
Gene Summary This gene encodes one of seven subunits of the human Arp2/3 protein complex. This complex controls actin polymerization in cells and has been conserved throughout eukaryotic evolution. This gene encodes the p20 subunit, which is necessary for actin nucleation and high-affinity binding to F-actin. Alternative splicing results in multiple transcript variants. Naturally occurring read-through transcription exists between this gene and the downstream tubulin tyrosine ligase-like family, member 3 (TTLL3), which results in the production of a fusion protein. [provided by RefSeq, Nov 2010]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region and uses a downstream start codon, compared to variant 1. The resulting isoform (b) is shorter at the N-terminus, compared to isoform a. Both variants 2 and 3 encode isoform b. CCDS Note: This CCDS represents a variant of the ARPC4 locus, and is supported by EST data, including BI768875.1, BQ688329.1, BU161393.1 and BG938423.1. A variant encoding a longer protein is represented by CCDS43047.1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...