MACROD2 (NM_001033087) Human Untagged Clone

CAT#: SC302700

MACROD2 (untagged)-Human MACRO domain containing 2 (MACROD2), transcript variant 2



  "NM_001033087" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C2orf133; C20orf133
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302700 representing NM_001033087.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAATGAGTTTTTCTCCGTAGACGATAATAATGAAGAAGAAGAGGATGTTGAAATGAAAGAAGATTCA
GATGAGAACGGTCCAGAGGAGAAGCAAAGTGTGGAAGAAATGGAAGAGCAGAGCCAAGATGCAGATGGT
GTCAACACTGTCACTGTGCCCGGCCCTGCTTCAGAAGAGGCAGTTGAAGACTGTAAAGATGAAGATTTT
GCAAAGGATGAAAATATTACAAAAGGCGGTGAAGTGACAGATCATTCTGTGCGTGACCAAGATCATCCC
GATGGACAAGAGAATGATTCAACGAAGAATGAAATAAAAATTGAAACAGAATCGCAGAGCTCATATATG
GAAACAGAAGAACTTTCATCAAACCAAGAAGATGCCGTGATTGTGGAGCAACCAGAAGTGATTCCATTA
ACAGAGGACCAAGAAGAAAAAGAAGGTGAAAAAGCTCCAGGCGAGGACACACCTAGGATGCCTGGGAAA
AGTGAAGGCTCCAGTGACCTAGAAAATACTCCAGGTCCTGATGTTGAAATGAATAGTCAGGTTGACAAG
GTAAATGACCCAACAGAGAGTCAACAAGAAGATCAACTAATAGCAGGGGCACAAGATGAAGCGAAGGAA
CAAAGAAATGGAACTAAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001033087
Insert Size 642 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001033087.1
RefSeq Size 4425 bp
RefSeq ORF 642 bp
Locus ID 140733
UniProt ID A1Z1Q3
MW 23.6 kDa
Gene Summary The protein encoded by this gene is a deacetylase involved in removing ADP-ribose from mono-ADP-ribosylated proteins. The encoded protein has been shown to translocate from the nucleus to the cytoplasm upon DNA damage. [provided by RefSeq, May 2017]
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 3. The resulting isoform (2) is shorter at the N-terminus compared to isoform 3.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...