ERP29 (NM_001034025) Human Untagged Clone
CAT#: SC302785
ERP29 (untagged)-Human endoplasmic reticulum protein 29 (ERP29), transcript variant 2
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C12orf8; ERp28; ERp31; HEL-S-107; PDI-DB; PDIA9 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001034025, the custom clone sequence may differ by one or more nucleotides
ATGGCTGCCGCTGTGCCCCGCGCCGCATTTCTCTCCCCGCTGCTTCCCCTTCTCCTGGGC TTCCTGCTCCTCTCCGCTCCGCATGGCGGCAGCGGCCTGCACACCAAGGGCGCCCTTCCC CTGGATACGGTCACTTTCTACAAGATTATGGTGACAAGCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001034025 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001034025.1, NP_001029197.1 |
RefSeq Size | 1333 bp |
RefSeq ORF | 162 bp |
Locus ID | 10961 |
UniProt ID | P30040 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a protein which localizes to the lumen of the endoplasmic reticulum (ER). It is a member of the protein disulfide isomerase (PDI) protein family but lacks an active thioredoxin motif, suggesting that this protein does not function as a disulfide isomerase. The canonical protein dimerizes and is thought to play a role in the processing of secretory proteins within the ER. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016] Transcript Variant: This variant (2) lacks an alternate exon in the coding region that results in a frameshift and an early stop codon, compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217346 | ERP29 (Myc-DDK-tagged)-Human endoplasmic reticulum protein 29 (ERP29), transcript variant 2 |
CNY 3990.00 |
|
RC217346L3 | Lenti-ORF clone of ERP29 (Myc-DDK-tagged)-Human endoplasmic reticulum protein 29 (ERP29), transcript variant 2 |
CNY 5890.00 |
|
RC217346L4 | Lenti-ORF clone of ERP29 (mGFP-tagged)-Human endoplasmic reticulum protein 29 (ERP29), transcript variant 2 |
CNY 5890.00 |
|
RG217346 | ERP29 (tGFP-tagged) - Human endoplasmic reticulum protein 29 (ERP29), transcript variant 2 |
CNY 4370.00 |