DAZL (NM_001351) Human Untagged Clone

CAT#: SC303003

DAZL (untagged)-Human deleted in azoospermia-like (DAZL), transcript variant 2



  "NM_001351" in other vectors (6)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
DAZL Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DAZH; DAZL1; DAZLA; SPGYLA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303003 representing NM_001351.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCTACTGCAAATCCTGAAACTCCAAACTCAACCATCTCCAGAGAGGCCAGCACCCAGTCCTCATCA
GCTGCAACCAGCCAAGGCTATATTTTACCAGAAGGCAAAATCATGCCAAACACTGTTTTTGTTGGAGGA
ATTGATGTTAGGATGGATGAAACTGAGATTAGAAGCTTCTTTGCTAGATATGGTTCAGTGAAAGAAGTG
AAGATAATCACTGATCGAACTGGTGTGTCCAAAGGCTATGGATTTGTTTCATTTTTTAATGACGTGGAT
GTGCAGAAGATAGTAGAATCACAGATAAATTTCCATGGTAAAAAGCTGAAGCTGGGCCCTGCAATCAGG
AAACAAAATTTATGTGCTTATCATGTGCAGCCACGTCCTTTGGTTTTTAATCATCCTCCTCCACCACAG
TTTCAGAATGTCTGGACTAATCCAAACACTGAAACTTATATGCAGCCCACAACCACGATGAATCCTATA
ACTCAGTATGTTCAGGCATATCCTACTTACCCAAATTCACCAGTTCAGGTCATCACTGGATATCAGTTG
CCTGTATATAATTATCAGATGCCACCACAGTGGCCTGTTGGGGAGCAAAGGAGCTATGTTGTACCTCCG
GCTTATTCAGCTGTTAACTACCACTGTAATGAAGTTGATCCAGGAGCTGAAGTTGTGCCAAATGAATGT
TCAGTTCATGAAGCTACTCCACCCTCTGGAAATGGCCCACAAAAGAAATCTGTGGACCGAAGCATACAA
ACGGTGGTATCTTGTCTGTTTAATCCAGAGAACAGACTGAGAAACTCTGTTGTTACTCAAGATGACTAC
TTCAAGGATAAAAGAGTGCATCACTTTAGAAGAAGTCGGGCAATGCTTAAATCTGTTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001351
Insert Size 888 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001351.3
RefSeq Size 3054 bp
RefSeq ORF 888 bp
Locus ID 1618
UniProt ID Q92904
MW 33.2 kDa
Gene Summary The DAZ (Deleted in AZoospermia) gene family encodes potential RNA binding proteins that are expressed in prenatal and postnatal germ cells of males and females. The protein encoded by this gene is localized to the nucleus and cytoplasm of fetal germ cells and to the cytoplasm of developing oocytes. In the testis, this protein is localized to the nucleus of spermatogonia but relocates to the cytoplasm during meiosis where it persists in spermatids and spermatozoa. Transposition and amplification of this autosomal gene during primate evolution gave rise to the DAZ gene cluster on the Y chromosome. Mutations in this gene have been linked to severe spermatogenic failure and infertility in males. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...