DMAC2L (NM_015684) Human Untagged Clone

CAT#: SC304340

ATP5S (untagged)-Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B) (ATP5S), nuclear gene encoding mitochondrial protein, transcript variant 3



  "NM_015684" in other vectors (4)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit polyclonal anti-ATP5S antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ATP5S; ATPW; FB; HSU79253
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_015684, the custom clone sequence may differ by one or more nucleotides
ATGTGCTGTGCGGTCTCTGAGCAGCGACTCACCTGTGCAGATCAAATGATGCCGTTTGGA
AAAATTTCCCAGCAGTTGTGTGGCGTAAAGAAACTCCCATGGTCATGTGACTCCAGATAC
TTCTGGGGCTGGTTGAATGCAGTGTTTAATAAGGTGGATTATGATCGCATCAGGGATGTT
GGCCCTGACAGGGCGGCATCCGAGTGGTTGCTGCGCTGTGGGGCCATGGTGCGCTACCAT
GGCCAGGAGAGGTGGCAGAAGGACTACAACCACCTTCCAACAGGCCCTCTGGACAAATAC
AAGATTCAGGCGATCGACGCCACCGACTCTTGTATCATGAGCATTGGATTTGATCACATG
GGTAACTACCCTATCGTTTTGCTAATAGAAAATGCAGATGATTTGCAGTGA
Restriction Sites Please inquire     
ACCN NM_015684
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_015684.2, NP_056499.2
RefSeq Size 1359 bp
RefSeq ORF 1359 bp
Locus ID 27109
UniProt ID Q99766
Gene Summary This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. This gene encodes the subunit s, also known as factor B, of the proton channel. This subunit is necessary for the energy transduction activity of the ATP synthase complexes. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) differs in the 5' UTR, 3' UTR, and the 3' coding region, compared to variant 4. The resulting isoform (c) contains a distinct C-terminus, compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...