beta Defensin 3 (DEFB103B) (NM_018661) Human Untagged Clone
CAT#: SC304620
DEFB103B (untagged)-Human defensin, beta 103B (DEFB103B)
CNY 1200.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BD-3; DEFB-3; DEFB3; DEFB103; HBD-3; HBD3; HBP-3; HBP3 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_018661 edited
ATGAGGATCCATTATCTTCTGTTTGCTTTGCTCTTCCTGTTTTTGGTGCCTGTTCCAGGT CATGGAGGAATCATAAACACATTACAGAAATATTATTGCAGAGTCAGAGGCGGCCGGTGT GCTGTGCTCAGCTGCCTTCCAAAGGAGGAACAGATCGGCAAGTGCTCGACGCGTGGCCGA AAATGCTGCCGAAGAAAGAAATAA |
| Restriction Sites | Please inquire |
| ACCN | NM_018661 |
| Insert Size | 200 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_018661.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_018661.2, NP_061131.1 |
| RefSeq Size | 523 bp |
| RefSeq ORF | 204 bp |
| Locus ID | 55894 |
| UniProt ID | P81534 |
| Protein Families | Secreted Protein, Transmembrane |
| Gene Summary | Defensins form a family of microbicidal and cytotoxic peptides made by neutrophils. Members of the defensin family are highly similar in protein sequence. This gene encodes defensin, beta 103, which has broad spectrum antimicrobial activity and may play an important role in innate epithelial defense. [provided by RefSeq, Oct 2014] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC223222 | DEFB103B (Myc-DDK-tagged)-Human defensin, beta 103B (DEFB103B) |
CNY 1200.00 |
|
| RC223222L1 | Lenti ORF clone of Human defensin, beta 103B (DEFB103B), Myc-DDK-tagged |
CNY 3600.00 |
|
| RC223222L2 | Lenti ORF clone of Human defensin, beta 103B (DEFB103B), mGFP tagged |
CNY 5890.00 |
|
| RC223222L3 | Lenti ORF clone of Human defensin, beta 103B (DEFB103B), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC223222L4 | Lenti ORF clone of Human defensin, beta 103B (DEFB103B), mGFP tagged |
CNY 5890.00 |
|
| RG223222 | DEFB103B (tGFP-tagged) - Human defensin, beta 103B (DEFB103B) |
CNY 2800.00 |
其它beta Defensin 3产品
