MMP26 (NM_021801) Human Untagged Clone

CAT#: SC304957

MMP26 (untagged)-Human matrix metallopeptidase 26 (MMP26)



  "NM_021801" in other vectors (6)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-MMP26 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC304957 representing NM_021801.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGCTCGTCATCTTAAGAGTTACTATCTTCTTGCCCTGGTGTTTCGCCGTTCCAGTGCCCCCTGCT
GCAGACCATAAAGGATGGGACTTTGTTGAGGGCTATTTCCATCAATTTTTCCTGACCAAGAAGGAGTCG
CCACTCCTTACCCAGGAGACACAAACACAGCTCCTGCAACAATTCCATCGGAATGGGACAGACCTACTT
GACATGCAGATGCATGCTCTGCTACACCAGCCCCACTGTGGGGTGCCTGATGGGTCCGACACCTCCATC
TCGCCAGGAAGATGCAAGTGGAATAAGCACACTCTAACTTACAGGATTATCAATTACCCACATGATATG
AAGCCATCCGCAGTGAAAGACAGTATATATAATGCAGTTTCCATCTGGAGCAATGTGACCCCTTTGATA
TTCCAGCAAGTGCAGAATGGAGATGCAGACATCAAGGTTTCTTTCTGGCAGTGGGCCCATGAAGATGGT
TGGCCCTTTGATGGGCCAGGTGGTATCTTAGGCCATGCCTTTTTACCAAATTCTGGAAATCCTGGAGTT
GTCCATTTTGACAAGAATGAACACTGGTCAGCTTCAGACACTGGATATAATCTGTTCCTGGTTGCAACT
CATGAGATTGGGCATTCTTTGGGCCTGCAGCACTCTGGGAATCAGAGCTCCATAATGTACCCCACTTAC
TGGTATCACGACCCTAGAACCTTCCAGCTCAGTGCCGATGATATCCAAAGGATCCAGCATTTGTATGGA
GAAAAATGTTCATCTGACATACCTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_021801
Insert Size 786 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_021801.4
RefSeq Size 1001 bp
RefSeq ORF 786 bp
Locus ID 56547
UniProt ID Q9NRE1
Protein Families Druggable Genome, Secreted Protein
MW 29.7 kDa
Gene Summary Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme may degrade collagen type IV, fibronectin, fibrinogen, and beta-casein, and activate matrix metalloproteinase-9 by cleavage. The protein differs from most MMP family members in that it lacks a conserved C-terminal protein domain. The encoded protein may promote cell invasion in multiple human cancers. [provided by RefSeq, May 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...