CACNG6 (NM_031897) Human Untagged Clone
CAT#: SC305359
CACNG6 (untagged)-Human calcium channel, voltage-dependent, gamma subunit 6 (CACNG6), transcript variant 3
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_031897, the custom clone sequence may differ by one or more nucleotides
ATGATGTGGTCCAACTTCTTCCTGCAAGAGGAGAACCGGCGGCGGGGGGCCGCGGGCCGG CGGCGGGCGCACGGGCAGGGCAGGTCGGGGCTGACGCCCGAGCGCGAGGGGAAGGTGAAG CTGGCGCTGCTGCTGGCCGCCGTGGGCGCCACGCTGGCGGTGCTGTCCGTGGGCACCGAG TTCTGGGTGGAGCTCAACACCTACAAGGCCAACGGCAGCGCCGTGTGCGAAGCGGCCCAC CTGGGGCTGTGGAAGGCGTGCACCAAGCGGCTGTGGCAGGCGGACGTGCCCGTGGACAGG GACACCTGCGGCCCCGCGGAGCTGCCCGGAGGCCTGCTGCTCTTGGTGAGCCTGGAGGTG TTCCGGCATTCCGTGAGGGCCCTGCTGCAGAGAGTCAGCCCGGAGCCTCCCCCGGCCCCA CGCCTCACCTACGAGTACTCCTGGTCCCTGGGCTGCGGCGTGGGGGCCGGCCTGATCCTG CTGTTGGGGGCCGGCTGCTTTCTGCTGCTCACACTGCCTTCCTGGCCCTGGGGGTCCCTC TGTCCCAAGCGGGGGCACCGGGCCACCTAG |
Restriction Sites | Please inquire |
ACCN | NM_031897 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_031897.2, NP_114103.2 |
RefSeq Size | 1673 bp |
RefSeq ORF | 570 bp |
Locus ID | 59285 |
UniProt ID | Q9BXT2 |
Protein Families | Druggable Genome, Ion Channels: Other, Transmembrane |
Protein Pathways | Arrhythmogenic right ventricular cardiomyopathy (ARVC), Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), MAPK signaling pathway |
Gene Summary | Voltage-dependent calcium channels are composed of five subunits. The protein encoded by this gene represents one of these subunits, gamma, and is one of two known gamma subunit proteins. This particular gamma subunit is an integral membrane protein that is thought to stabilize the calcium channel in an inactive (closed) state. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members that function as transmembrane AMPA receptor regulatory proteins (TARPs). Alternative splicing results in multiple transcript variants. Variants in this gene have been associated with aspirin-intolerant asthma. [provided by RefSeq, Dec 2010] Transcript Variant: This variant (3) lacks two alternate in-frame exons in the central coding region, compared to variant 1, resulting in a shorter isoform (c) with the same N- and C-termini as isoform a. This variant lacks publicly available transcript support but it is supported by RT-PCR data in PubMed ID:11170751. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216398 | CACNG6 (Myc-DDK-tagged)-Human calcium channel, voltage-dependent, gamma subunit 6 (CACNG6), transcript variant 3 |
CNY 3,990.00 |
|
RC216398L3 | Lenti-ORF clone of CACNG6 (Myc-DDK-tagged)-Human calcium channel, voltage-dependent, gamma subunit 6 (CACNG6), transcript variant 3 |
CNY 5,890.00 |
|
RC216398L4 | Lenti-ORF clone of CACNG6 (mGFP-tagged)-Human calcium channel, voltage-dependent, gamma subunit 6 (CACNG6), transcript variant 3 |
CNY 5,890.00 |
|
RG216398 | CACNG6 (tGFP-tagged) - Human calcium channel, voltage-dependent, gamma subunit 6 (CACNG6), transcript variant 3 |
CNY 4,370.00 |