SPANXA2 (NM_145662) Human Untagged Clone

CAT#: SC306256

SPANXA2 (untagged)-Human SPANX family, member A2 (SPANXA2)



  "NM_145662" in other vectors (4)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CT11.1; CT11.3; SPANX; SPANX-A; SPANX-C; SPANXA; SPANXC
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_145662, the custom clone sequence may differ by one or more nucleotides
ATGGACAAACAATCCAGTGCCGGCGGGGTGAAGAGGAGCGTCCCCTGTGATTCCAACGAG
GCCAACGAGATGATGCCGGAGACCCCAACTGGGGACTCAGACCCGCAACCTGCTCCTAAA
AAAATGAAAACATCTGAGTCCTCGACCATACTAGTGGTTCGCTACAGGAGGAACTTTAAA
AGAACATCTCCAGAGGAACTGCTGAATGACCACGCCCGAGAGAACAGAATCAACCCCCTC
CAAATGGAGGAGGAGGAATTCATGGAAATAATGGTTGAAATACCTGCAAAGTAG
Restriction Sites Please inquire     
ACCN NM_145662
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_145662.2, NP_663695.1
RefSeq Size 420 bp
RefSeq ORF 294 bp
Locus ID 728712
UniProt ID Q9NS26
Gene Summary Temporally regulated transcription and translation of several testis-specific genes is required to initiate the series of molecular and morphological changes in the male germ cell lineage necessary for the formation of mature spermatozoa. This gene is a member of the SPANX family of cancer/testis-associated genes, which are located in a cluster on chromosome X. The SPANX genes encode differentially expressed testis-specific proteins that localize to various subcellular compartments. This particular gene maps to chromosome X in a head-to-head orientation with SPANX family member A1 and appears to be a duplication of that locus. The protein encoded by this gene targets to the nucleus where it associates with nuclear vacuoles and the redundant nuclear envelope. Based on its association with these poorly characterized regions of the sperm nucleus, this protein provides a biochemical marker to study unique structures in spermatazoa while attempting to further define its role in spermatogenesis. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...