HYAL1 (NM_153285) Human Untagged Clone
CAT#: SC306579
HYAL1 (untagged)-Human hyaluronoglucosaminidase 1 (HYAL1), transcript variant 5
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HYAL-1; LUCA1; MPS9; NAT6 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_153285, the custom clone sequence may differ by one or more nucleotides
ATGTATGTGCAACACCGTGTGGCCGAGGCATTCCGTGTGGCTGTGGCTGCTGGTGACCCC AATCTGCCGGTGCTGCCCTATGTCCAGATCTTCTATGACACGACAAACCACTTTCTGCCC CTGGATGAGCTGGAGCACAGCCTGGGGGAGAGTGCGGCCCAGGGGGCAGCTGGAGTGGTG CTCTGGGTGAGCTGGGAAAATACAAGAACCAAGGAATCATGTCAGGCCATCAAGGAGTAT ATGGACACTACACTGGGGCCCTTCATCCTGAACGTGACCAGTGGGGCCCTTCTCTGCAGT CAAGCCCTGTGCTCCGGCCATGGCCGCTGTGTCCGCCGCACCAGCCACCCCAAAGCCCTC CTCCTCCTTAACCCTGCCAGTTTCTCCATCCAGCTCACGCCTGGTGGTGGGCCCCTGAGC CTGCGGGGTGCCCTCTCACTTGAAGATCAGGCACAGATGGCTGTGGAGTTCAAATGTCGA TGCTACCCTGGCTGGCAGGCACCGTGGTGTGAGCGGAAGAGCATGTGGTGA |
Restriction Sites | Please inquire |
ACCN | NM_153285 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_153285.1, NP_695017.1 |
RefSeq Size | 1300 bp |
RefSeq ORF | 531 bp |
Locus ID | 3373 |
UniProt ID | Q12794 |
Protein Families | Secreted Protein |
Protein Pathways | Glycosaminoglycan degradation, Lysosome, Metabolic pathways |
Gene Summary | This gene encodes a lysosomal hyaluronidase. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. This enzyme is active at an acidic pH and is the major hyaluronidase in plasma. Mutations in this gene are associated with mucopolysaccharidosis type IX, or hyaluronidase deficiency. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (5) lacks an internal segment including a part of the 5' UTR and a part of the coding region, as compared to variant 8. The resulting isoform (5) has a shorter N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC207715 | HYAL1 (Myc-DDK-tagged)-Human hyaluronoglucosaminidase 1 (HYAL1), transcript variant 5 |
CNY 3990.00 |
|
RC207715L3 | Lenti-ORF clone of HYAL1 (Myc-DDK-tagged)-Human hyaluronoglucosaminidase 1 (HYAL1), transcript variant 5 |
CNY 5890.00 |
|
RC207715L4 | Lenti-ORF clone of HYAL1 (mGFP-tagged)-Human hyaluronoglucosaminidase 1 (HYAL1), transcript variant 5 |
CNY 5890.00 |
|
RG207715 | HYAL1 (tGFP-tagged) - Human hyaluronoglucosaminidase 1 (HYAL1), transcript variant 5 |
CNY 4370.00 |