PIGP (NM_153681) Human Untagged Clone
CAT#: SC306639
PIGP (untagged)-Human phosphatidylinositol glycan anchor biosynthesis, class P (PIGP), transcript variant 1
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DCRC; DCRC-S; DEE55; DSCR5; DSRC; EIEE55; PIG-P |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_153681, the custom clone sequence may differ by one or more nucleotides
ATGGTGCCACGGAGCACATCGCTGACGCTGATTGTGTTCCTTTTCCACAGATTGTCTAAA GCCCCAGGAAAAATGGTGGAAAATTCACCGTCGCCATTGCCAGAAAGAGCGATTTATGGC TTTGTTCTTTTCTTAAGCTCCCAATTTGGCTTCATACTTTACCTCGTGTGGGCCTTTATT CCTGAATCTTGGCTAAACTCTTTAGGTTTAACCTATTGGCCTCAAAAATATTGGGCAGTT GCATTACCTGTCTACCTCCTTATTGCTATAGTAATTGGCTACGTGCTCTTGTTTGGGATT AACATGATGAGTACCTCTCCACTCGACTCCATCCATACAATCACAGATAACTATGCAAAA AATCAACAGCAGAAGAAATACCAAGAGGAGGCCATTCCAGCCTTAAGAGATATTTCTATT AGTGAAGTAAACCAAATGTTCTTTCTTGCAGCCAAAGAACTTTACACCAAAAACTGA |
Restriction Sites | Please inquire |
ACCN | NM_153681 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_153681.2, NP_710148.1 |
RefSeq Size | 911 bp |
RefSeq ORF | 477 bp |
Locus ID | 51227 |
UniProt ID | P57054 |
Protein Families | Transmembrane |
Protein Pathways | Glycosylphosphatidylinositol(GPI)-anchor biosynthesis, Metabolic pathways |
Gene Summary | This gene encodes an enzyme involved in the first step of glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells that serves to anchor proteins to the cell surface. The encoded protein is a component of the GPI-N-acetylglucosaminyltransferase complex that catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI). This gene is located in the Down Syndrome critical region on chromosome 21 and is a candidate for the pathogenesis of Down syndrome. This gene has multiple pseudogenes and is a member of the phosphatidylinositol glycan anchor biosynthesis gene family. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (1) encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223197 | PIGP (Myc-DDK-tagged)-Human phosphatidylinositol glycan anchor biosynthesis, class P (PIGP), transcript variant 1 |
CNY 3990.00 |
|
RC223197L3 | Lenti-ORF clone of PIGP (Myc-DDK-tagged)-Human phosphatidylinositol glycan anchor biosynthesis, class P (PIGP), transcript variant 1 |
CNY 5890.00 |
|
RC223197L4 | Lenti-ORF clone of PIGP (mGFP-tagged)-Human phosphatidylinositol glycan anchor biosynthesis, class P (PIGP), transcript variant 1 |
CNY 5890.00 |
|
RG223197 | PIGP (tGFP-tagged) - Human phosphatidylinositol glycan anchor biosynthesis, class P (PIGP), transcript variant 1 |
CNY 4370.00 |