MHF1 (CENPS) (NM_199294) Human Untagged Clone
CAT#: SC307926
APITD1 (untagged)-Human apoptosis-inducing, TAF9-like domain 1 (APITD1), transcript variant A
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | APITD1; CENP-S; FAAP16; MHF1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_199294, the custom clone sequence may differ by one or more nucleotides
ATGGAGGAGGAGGCGGAGACCGAGGAGCAGCAGCGATTCTCTTACCAACAGAGGCTAAAG GCAGCAGTTCACTATACTGTGGGTTGTCTTTGCGAGGAAGTTGCATTGGACAAAGAGATG CAGTTCAGCAAACAGACCATTGCGGCCATTTCGGAGCTGACTTTCCGACAGTGTGAAAAT TTTGCCAAAGACCTTGAAATGTTTGCAAGACATGCGAAAAGAACCACAATTAACACTGAA GATGTGAAGCTCTTAGCCAGGAGGAGTAATTCACTGCTAAAATACATCACAGACAAAAGT GAAGAGATTGCTCAGATTAACCTAGAACGAAAAGCACAGAAGAAAAAGAAGTCAGAGGAT GGAAGCAAAAATTCAAGGCAGCCAGCAGAGGCTGGAGTGGTGGAAAGTGAGAATTAA |
Restriction Sites | Please inquire |
ACCN | NM_199294 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_199294.1, NP_954988.1 |
RefSeq Size | 1251 bp |
RefSeq ORF | 417 bp |
Locus ID | 378708 |
UniProt ID | Q8N2Z9 |
Gene Summary | This gene was identified in the neuroblastoma tumor suppressor candidate region on chromosome 1p36. It contains a TFIID-31 domain, similar to that found in TATA box-binding protein-associated factor, TAF(II)31, which is required for p53-mediated transcription activation. This gene was expressed at very low levels in neuroblastoma tumors, and was shown to reduce cell growth in neuroblastoma cells, suggesting that it may have a role in a cell death pathway. The protein is a component of multiple complexes, including the Fanconi anemia (FA) core complex, the APITD1/CENPS complex, and the CENPA-CAD (nucleosome distal) complex. Known functions include an involvement with chromatin associations of the FA core complex, and a role in the stable assembly of the outer kinetochore. Alternative splicing of this gene results in multiple transcript variants. Naturally occurring read-through transcripts also exist between this gene and the downstream cortistatin (CORT) gene, as represented in GeneID:100526739. An APITD1-related pseudogene has been identified on chromosome 7. [provided by RefSeq, Nov 2010] Transcript Variant: This variant (A) represents the shorter transcript but encodes the functional protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205926 | APITD1 (Myc-DDK-tagged)-Human apoptosis-inducing, TAF9-like domain 1 (APITD1), transcript variant A |
CNY 3990.00 |
|
RC205926L3 | Lenti-ORF clone of APITD1 (Myc-DDK-tagged)-Human apoptosis-inducing, TAF9-like domain 1 (APITD1), transcript variant A |
CNY 5890.00 |
|
RC205926L4 | Lenti-ORF clone of APITD1 (mGFP-tagged)-Human apoptosis-inducing, TAF9-like domain 1 (APITD1), transcript variant A |
CNY 5890.00 |
|
RG205926 | APITD1 (tGFP-tagged) - Human apoptosis-inducing, TAF9-like domain 1 (APITD1), transcript variant A |
CNY 4370.00 |