TPD52L2 (NM_199363) Human Untagged Clone
CAT#: SC307960
TPD52L2 (untagged)-Human tumor protein D52-like 2 (TPD52L2), transcript variant 4
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | D54; TPD54 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_199363, the custom clone sequence may differ by one or more nucleotides
ATGGACTCCGCCGGCCAAGATATCAACCTGAATTCTCCTAACAAAGGTCTGCTGTCTGAC TCCATGACGGATGTTCCTGTCGACACAGGTGTGGCTGCCCGGACTCCTGCTGTTGAGGGT CTGACAGAGGCTGAGGAGGAGGAGCTCAGGGCTGAGCTTACCAAGGTGGAAGAGGAAATT GTCACTCTGCGCCAGGTCCTGGCAGCCAAGGAGAGGCACTGTGGAGAGCTCAAGAGGAGG CTGGGCCTCTCCACCCTGGGGGAGCTGAAACAGAACCTGTCCAGGAGCTGGCATGACGTG CAGGTCTCTAGCGCCTACAAGAAGACTCAGGAAACTCTTTCACAGGCAGGACAGAAGACT TCAGCTGCCCTGTCCACAGTGGGCTCTGCCATCAGCAGGAAGCTTGGAGACATGAGCAGC TACTCCATCCGCCACTCAATAAGTATGCCAGCCATGAGGAACTCTGCGACCTTCAAGTCG TTTGAGGACCGAGTTGGGACCATAAAGTCTAAGGTTGTGGGTGACAGAGAGAACGGCAGT GACAACCTCCCTTCCTCAGCGGGGAGTGGTGACAAGCCCCTGTCGGATCCCGCACCTTTC TAA |
Restriction Sites | Please inquire |
ACCN | NM_199363 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_199363.1, NP_955395.1 |
RefSeq Size | 2339 bp |
RefSeq ORF | 603 bp |
Locus ID | 7165 |
UniProt ID | O43399 |
Gene Summary | This gene encodes a member of the tumor protein D52-like family. These proteins are characterized by an N-terminal coiled-coil motif that is used to form homo- and heteromeric complexes with other tumor protein D52-like proteins. Expression of this gene may be a marker for breast cancer and acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 12. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (4) lacks two exons in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (d) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223134 | TPD52L2 (Myc-DDK-tagged)-Human tumor protein D52-like 2 (TPD52L2), transcript variant 4 |
CNY 3990.00 |
|
RC223134L3 | Lenti-ORF clone of TPD52L2 (Myc-DDK-tagged)-Human tumor protein D52-like 2 (TPD52L2), transcript variant 4 |
CNY 5890.00 |
|
RC223134L4 | Lenti-ORF clone of TPD52L2 (mGFP-tagged)-Human tumor protein D52-like 2 (TPD52L2), transcript variant 4 |
CNY 5890.00 |
|
RG223134 | TPD52L2 (tGFP-tagged) - Human tumor protein D52-like 2 (TPD52L2), transcript variant 4 |
CNY 4370.00 |
其它TPD52L2产品