ATP6V1H (NM_213619) Human Untagged Clone

CAT#: SC308682

ATP6V1H (untagged)-Human ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H (ATP6V1H), transcript variant 2



  "NM_213619" in other vectors (6)

CNY 7410.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
Rabbit Polyclonal antibody to ATP6V1H (ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H)
    • 100 ul

CNY 6281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CGI-11; MSTP042; NBP1; SFD; SFDalpha; SFDbeta; VMA13
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC308682 representing NM_213619.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCAAAATGGATATCCGAGGTGCTGTGGATGCTGCTGTCCCCACCAATATTATTGCTGCCAAGGCT
GCAGAAGTTCGTGCAAACAAAGTCAACTGGCAATCCTATCTTCAGGGACAGATGATTTCTGCTGAAGAT
TGTGAGTTTATTCAGAGGTTTGAAATGAAACGAAGCCCTGAAGAGAAGCAAGAGATGCTTCAAACTGAA
GGCAGCCAGTGTGCTAAAACATTTATAAATCTGATGACTCATATCTGCAAAGAACAGACCGTTCAGTAT
ATACTAACTATGGTGGATGATATGCTGCAGGAAAATCATCAGCGTGTTAGCATTTTCTTTGACTATGCA
AGATGTAGCAAGAACACTGCGTGGCCCTACTTTCTGCCAATGTTGAATCGCCAGGATCCCTTCACTGTT
CATATGGCAGCAAGAATTATTGCCAAGTTAGCAGCTTGGGGAAAAGAACTGATGGAAGGCAGTGACTTA
AATTACTATTTCAATTGGATAAAAACTCAGCTGAGTTCACAGAGTTCGCAGTATGTGCAGTGCGTGGCC
GGGTGTTTGCAGCTGATGCTCCGGGTCAATGAGTACCGCTTTGCTTGGGTGGAAGCAGATGGGGTAAAT
TGCATAATGGGAGTGTTGAGTAACAAGTGTGGCTTTCAGCTCCAGTATCAAATGATTTTTTCAATATGG
CTCCTGGCATTCAGTCCTCAAATGTGTGAACACCTGCGGCGCTATAATATCATTCCAGTTCTGTCTGAT
ATCCTTCAGGAGTCTGTCAAAGAGAAAGTAACAAGAATCATTCTTGCAGCATTTCGTAACTTTTTAGAA
AAATCAACTGAAAGAGAAACTCGCCAAGAATATGCCCTGGCTATGATTCAGTGCAAAGTTCTGAAACAG
TTGGAGAACTTGGAACAGCAGAAGTACGATGATGAAGATATCAGCGAAGATATCAAATTTCTTTTGGAA
AAACTTGGAGAGAGTGTCCAGGACCTTAGTTCATTTGATGAATACAGTTCAGAACTTAAATCTGGAAGG
TTGGAATGGAGTCCTGTGCACAAATCTGAGAAATTTTGGAGAGAGAATGCTGTGAGGTTAAATGAGAAG
AATTATGAACTCTTGAAAATCTTGACAAAACTTTTGGAAGTGTCAGATGATCCCCAAGTCTTAGCTGTT
GCTGCTCACGATGTTGGAGAATATGTGCGGCATTATCCACGAGGCAAACGGGTCATCGAGCAGCTCGGT
GGGAAGCAGCTGGTCATGAACCACATGCATCATGAAGACCAGCAGGTCCGCTATAATGCTCTGCTGGCC
GTGCAGAAGCTCATGGTGCACAACTGGGAATACCTTGGCAAGCAGCTCCAGTCCGAGCAGCCCCAGACC
GCTGCCGCCCGAAGCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_213619
Insert Size 1398 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_213619.2
RefSeq Size 2132 bp
RefSeq ORF 1398 bp
Locus ID 51606
UniProt ID Q9UI12
Protein Pathways Epithelial cell signaling in Helicobacter pylori infection, Lysosome, Metabolic pathways, Oxidative phosphorylation, Vibrio cholerae infection
MW 54.2 kDa
Gene Summary This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular organelles. V-ATPase-dependent organelle acidification is necessary for multiple processes including protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. The encoded protein is the regulatory H subunit of the V1 domain of V-ATPase, which is required for catalysis of ATP but not the assembly of V-ATPase. Decreased expression of this gene may play a role in the development of type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
Transcript Variant: This variant (2) lacks an exon in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...