CYB5R3 (NM_007326) Human Untagged Clone

CAT#: SC308951

CYB5R3 (untagged)-Human cytochrome b5 reductase 3 (CYB5R3), transcript variant 2



  "NM_007326" in other vectors (6)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
CYB5R3 mouse monoclonal antibody, clone OTI2A10 (formerly 2A10)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms B5R; DIA1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC308951 representing NM_007326.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGCTGTTCCAGCGCTCCACGCCAGCCATCACCCTCGAGAGCCCGGACATCAAGTACCCGCTGCGG
CTCATCGACCGGGAGATCATCAGCCATGACACCCGGCGCTTCCGCTTTGCCCTGCCGTCACCCCAGCAC
ATCCTGGGCCTCCCTGTCGGCCAGCACATCTACCTCTCGGCTCGAATTGATGGAAACCTGGTCGTCCGG
CCCTATACACCCATCTCCAGCGATGATGACAAGGGCTTCGTGGACCTGGTCATCAAGGTTTACTTCAAG
GACACCCATCCCAAGTTTCCCGCTGGAGGGAAGATGTCTCAGTACCTGGAGAGCATGCAGATTGGAGAC
ACCATTGAGTTCCGGGGCCCCAGTGGGCTGCTGGTCTACCAGGGCAAAGGGAAGTTCGCCATCCGACCT
GACAAAAAGTCCAACCCTATCATCAGGACAGTGAAGTCTGTGGGCATGATCGCGGGAGGGACAGGCATC
ACCCCGATGCTGCAGGTGATCCGCGCCATCATGAAGGACCCTGATGACCACACTGTGTGCCACCTGCTC
TTTGCCAACCAGACCGAGAAGGACATCCTGCTGCGACCTGAGCTGGAGGAACTCAGGAACAAACATTCT
GCACGCTTCAAGCTCTGGTACACGCTGGACAGAGCCCCTGAAGCCTGGGACTACGGCCAGGGCTTCGTG
AATGAGGAGATGATCCGGGACCACCTTCCACCCCCAGAGGAGGAGCCGCTGGTGCTGATGTGTGGCCCC
CCACCCATGATCCAGTACGCCTGCCTTCCCAACCTGGACCACGTGGGCCACCCCACGGAGCGCTGCTTC
GTCTTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_007326
Insert Size 837 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_007326.4
RefSeq Size 2922 bp
RefSeq ORF 837 bp
Locus ID 1727
UniProt ID P00387
Protein Families Druggable Genome
Protein Pathways Amino sugar and nucleotide sugar metabolism
MW 31.6 kDa
Gene Summary This gene encodes cytochrome b5 reductase, which includes a membrane-bound form in somatic cells (anchored in the endoplasmic reticulum, mitochondrial and other membranes) and a soluble form in erythrocytes. The membrane-bound form exists mainly on the cytoplasmic side of the endoplasmic reticulum and functions in desaturation and elongation of fatty acids, in cholesterol biosynthesis, and in drug metabolism. The erythrocyte form is located in a soluble fraction of circulating erythrocytes and is involved in methemoglobin reduction. The membrane-bound form has both membrane-binding and catalytic domains, while the soluble form has only the catalytic domain. Alternate splicing results in multiple transcript variants. Mutations in this gene cause methemoglobinemias. [provided by RefSeq, Jan 2010]
Transcript Variant: This variant (2) uses an alternate exon in the 5' UTR and 5' coding region, compared to variant 1. The resulting isoform (2) is the soluble form of the enzyme, which has a shorter N-terminus when it is compared to the membrane-bound form. This isoform (2) is referred to in the literature as isoform s. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...