CLCN6 (NM_021737) Human Untagged Clone
CAT#: SC309476
CLCN6 (untagged)-Human chloride channel 6 (CLCN6), transcript variant ClC-6d
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CLC-6; KIAA0046 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_021737, the custom clone sequence may differ by one or more nucleotides
ATGGCGGGGTGCAGGGGGTCTCTGTGCTGCTGCTGCAGGTGGTGCTGCTGCTGCGGTGAG CGTGAGACCCGCACCCCCGAGGAGCTGACCATCCTTGGAGAAACACAGGAGGAGGAGGAT GAGATTCTTCCAAGGAAAGACTATGAGAGTTTGGATTATGATCGCTGTATCAATGACCCT TACCTGGAAGTTTTGGAGACCATGGATAATAAGAAAGGTCGAAGATATGAGGCGGTGAAG TGGATGGTGGTGTTTGCCATTGGAGTCTGCACTGGCCTGGTGGGTCTCTTTGTGGACTTT TTTGTGCGACTCTTCACCCAACTCAAGTTCGGAGTGGTACAGACATCGGTGGAGGAGTGC AGCCAGAAAGGCTGCCTCGCTCTGTCTCTCCTTGAACTCCTGGGTTTTAACCTCACCTTT GTCTTCCTGGCAAGCCTCCTTGTTCTCATTGAGCCGGTGGCAGCAGGTTCCGGGATACCC GAGGTCAAATGCTATCTGAATGGCGTAAAGGTGCCAGGAATCGTCCGTCTCCGGACCCTG CTCTGCAAGGTCCTTGGAGTGCTGTTCAGTGTGGCTGGAGGGCTCTTCGTGGGGAAGGAA GGCCCCATGATCCACAGTGGTTCGGTGGTGGGAGCTGGCCTCCCTCAGTTTCAGAGCATC TCCTTACGGAAGATCCAGTTTAACTTCCCCTATTTCCGAAGCGACAGGAGCGGCTGCTGG AGTTGCTGCAGCTTTCGGGGCGCCAATCGGGGGTACCTTGTTCAGTCTAGAGGAGGGTTC GTCCTTCTGGAACCAAGGGCTCACGTGGAAAGTGCTCTTTTGTTCCATGTCTGCCACCTT CACCCTCAACTTCTTCCGTTCTGGGATTCAGTTTGGAAGCTGGGGTTCCTTCCAGCTCCC TGGATTGCTGAACTTTGGCGAGTTTAA |
Restriction Sites | Please inquire |
ACCN | NM_021737 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_021737.1, NP_068505.1 |
RefSeq Size | 3858 bp |
RefSeq ORF | 927 bp |
Locus ID | 1185 |
Domains | voltage_CLC |
Protein Families | Druggable Genome, Ion Channels: Other, Transmembrane |
Gene Summary | This gene encodes a member of the voltage-dependent chloride channel protein family. Members of this family can function as either chloride channels or antiporters. This protein is primarily localized to late endosomes and functions as a chloride/proton antiporter. Alternate splicing results in both coding and non-coding variants. Additional alternately spliced variants have been described but their full-length structure is unknown. [provided by RefSeq, Mar 2012] Transcript Variant: This variant (ClC-6d) lacks an internal coding segment of 26 nts and multiple 3' coding exons, as compared to variant ClC-6a. The resulting isoform ClC-6d has a shorter and distinct C-terminus, as compared to ClC-6a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217449 | CLCN6 (Myc-DDK-tagged)-Human chloride channel 6 (CLCN6), transcript variant ClC-6d |
CNY 2400.00 |
|
RC217449L3 | Lenti ORF clone of Human chloride channel 6 (CLCN6), transcript variant ClC-6d, Myc-DDK-tagged |
CNY 5890.00 |
|
RC217449L4 | Lenti ORF clone of Human chloride channel 6 (CLCN6), transcript variant ClC-6d, mGFP tagged |
CNY 5890.00 |
|
RG217449 | CLCN6 (tGFP-tagged) - Human chloride channel 6 (CLCN6), transcript variant ClC-6d |
CNY 4370.00 |