KCNJ15 (NM_170736) Human Untagged Clone

CAT#: SC309509

KCNJ15 (untagged)-Human potassium inwardly-rectifying channel, subfamily J, member 15 (KCNJ15), transcript variant 1



  "NM_170736" in other vectors (4)

CNY 3656.00

CNY 7220.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
KCNJ15 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms IRKK; KIR1.3; KIR4.2
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_170736, the custom clone sequence may differ by one or more nucleotides


ATGGATGCCATTCACATCGGCATGTCCAGCACCCCCCTGGTGAAGCACACTGCTGGGGCTGGGCTCAAGG
CCAACAGACCCCGCGTCATGTCCAAGAGTGGGCACAGCAACGTGAGAATTGACAAAGTGGATGGCATATA
CCTACTCTACCTGCAAGACCTGTGGACCACAGTTATCGACATGAAGTGGAGATACAAACTCACCCTGTTC
GCTGCCACTTTTGTGATGACCTGGTTCCTTTTTGGAGTCATCTACTATGCCATCGCGTTTATTCATGGGG
ACTTAGAACCCGGTGAGCCCATTTCAAATCATACCCCCTGCATCATGAAAGTGGACTCTCTCACTGGGGC
GTTTCTCTTTTCCCTGGAATCCCAGACAACCATTGGCTATGGAGTCCGTTCCATCACAGAGGAATGTCCT
CATGCCATCTTCCTGTTGGTTGCTCAGTTGGTCATCACGACCTTGATTGAGATCTTCATCACCGGAACCT
TCCTGGCCAAAATCGCCAGACCCAAAAAGCGGGCTGAGACCATCAAGTTCAGCCACTGTGCAGTCATCAC
CAAGCAGAATGGGAAGCTGTGCTTGGTGATTCAGGTAGCCAATATGAGGAAGAGCCTCTTGATTCAGTGC
CAGCTCTCTGGCAAGCTCCTGCAGACCCACGTCACCAAGGAGGGGGAGCGGATTCTCCTCAACCAAGCCA
CTGTCAAATTCCACGTGGACTCCTCCTCTGAGAGCCCCTTCCTCATTCTGCCCATGACATTCTACCATGT
GCTGGATGAGACGAGCCCCCTGAGAGACCTCACACCCCAAAACCTAAAGGAGAAGGAGTTTGAGCTTGTG
GTCCTCCTCAATGCCACTGTGGAATCCACCAGCGCTGTCTGCCAGAGCCGAACATCTTATATCCCAGAGG
AAATCTACTGGGGTTTTGAGTTTGTGCCTGTGGTATCTCTCTCCAAAAATGGAAAATATGTGGCTGATTT
CAGTCAGTTTGAACAGATTCGGAAAAGCCCAGATTGCACATTTTACTGTGCAGATTCTGAGAAACAGCAA
CTCGAGGAGAAGTACAGGCAGGAGGATCAGAGGGAAAGAGAACTGAGGACACTTTTATTACAACAGAGCA
ATGTCTGA


Restriction Sites NotI-NotI     
ACCN NM_170736
Insert Size 4700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_170736.1, NP_733932.1
RefSeq Size 2919 bp
RefSeq ORF 1128 bp
Locus ID 3772
UniProt ID Q99712
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
Gene Summary Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Eight transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2013]
Transcript Variant: This variant (1) represents the longest transcript. All eight variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...