CCL14 (NM_032962) Human Untagged Clone

CAT#: SC309560

CCL14 (untagged)-Human chemokine (C-C motif) ligand 14 (CCL14), transcript variant 2



  "NM_032962" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CCL14 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CC-1; CC-3; CKB1; HCC-1; HCC-1(1-74); HCC-1/HCC-3; HCC-3; MCIF; NCC-2; NCC2; SCYA14; SCYL2; SY14
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_032962, the custom clone sequence may differ by one or more nucleotides
ATGAAGATCTCCGTGGCTGCCATTCCCTTCTTCCTCCTCATCACCATCGCCCTAGGGACC
AAGACTGAATCCTCCTCACAAACTGGGGGGAAACCGAAGGTTGTTAAAATACAGCTAAAG
TTGGTGGGGGGACCTTACCACCCCTCAGAGTGCTGCTTCACCTACACTACCTACAAGATC
CCGCGTCAGCGGATTATGGATTACTATGAGACCAACAGCCAGTGCTCCAAGCCCGGAATT
GTCTTCATCACCAAAAGGGGCCATTCCGTCTGTACCAACCCCAGTGACAAGTGGGTCCAG
GACTATATCAAGGACATGAAGGAGAACTGA
Restriction Sites Please inquire     
ACCN NM_032962
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_032962.2, NP_116738.1
RefSeq Size 1392 bp
RefSeq ORF 579 bp
Locus ID 6358
UniProt ID Q16627
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Chemokine signaling pathway, Cytokine-cytokine receptor interaction
Gene Summary This gene, chemokine (C-C motif) ligand 14, is one of several CC cytokine genes clustered on 17q11.2. The CC cytokines are secreted proteins characterized by two adjacent cysteines. The cytokine encoded by this gene induces changes in intracellular calcium concentration and enzyme release in monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Read-through transcripts are also expressed that include exons from the upstream cytokine gene, chemokine (C-C motif) ligand 15, and are represented as GeneID: 348249. [provided by RefSeq, Dec 2009]
Transcript Variant: This variant (2, also known as CCL14b) represents the longer transcript and encodes the longer isoform (2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...