RNF14 (NM_183398) Human Untagged Clone

CAT#: SC310517

RNF14 (untagged)-Human ring finger protein 14 (RNF14), transcript variant 2



  "NM_183398" in other vectors (4)

CNY 7220.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
RNF14 mouse monoclonal antibody,clone OTI1C9
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARA54; HFB30; HRIHFB2038; TRIAD2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_183398, the custom clone sequence may differ by one or more nucleotides
ATGCAATTTCTTAAGGAAGAGACCCTAGCATACTTGAATATTGTCTCTCCTTTTGAGCTC
AAGATTGGTTCTCAGAAAAAAGTGCAGAGAAGGACAGCTCAAGCTTCTCCCAACACAGAG
CTAGATTTTGGAGGAGCTGCTGGATCTGATGTAGACCAAGAGGAAATTGTGGATGAGAGA
GCAGTGCAGGATGTGGAATCACTGTCAAATCTGATCCAGGAAATCTTGGACTTTGATCAA
GCTCAGCAGATAAAATGCTTTAATAGTAAATTGTTCCTGTGCAGTATCTGTTTCTGTGAG
AAGCTGGGTAGTGAATGCATGTACTTCTTGGAGTGCAGGCATGTGTACTGCAAAGCCTGT
CTGAAGGACTACTTTGAAATCCAGATCAGAGATGGCCAGGTTCAATGCCTCAACTGCCCA
GAACCAAAGTGCCCTTCGGTGGCCACTCCTGGTCAGGTCAAAGAGTTAGTGGAAGCAGAG
TTATTTGCCCGTTATGACCGCCTTCTCCTCCAGTCCTCCTTGGACCTGATGGCAGATGTG
GTGTACTGCCCCCGGCCGTGCTGCCAGCTGCCTGTGATGCAGGAACCTGGCTGCACCATG
GGTATCTGCTCCAGCTGCAATTTTGCCTTCTGTACTTTGTGCAGGTTGACCTACCATGGG
GTCTCCCCATGTAAGGTGACTGCAGAGAAATTAATGGACTTACGAAATGAATACCTGCAA
GCGGATGAGGCTAATAAAAGACTTTTGGATCAAAGGTATGGTAAGAGAGTGATTCAGAAG
GCACTGGAAGAGATGGAAAGTAAGGAGTGGCTAGAGAAGAACTCAAAGAGCTGCCCATGT
TGTGGAACTCCCATAGAGAAATTAGACGGATGTAACAAGATGACATGTACTGGCTGTATG
CAATATTTCTGTTGGATTTGCATGGGTTCTCTCTCTAGAGCAAACCCTTACAAACATTTC
AATGACCCTGGTTCACCATGTTTTAACCGGCTGTTTTATGCTGTGGATGTTGACGACGAT
ATTTGGGAAGATGAGGTAGAAGACTAG
Restriction Sites Please inquire     
ACCN NM_183398
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_183398.1, NP_899645.1
RefSeq Size 2992 bp
RefSeq ORF 1047 bp
Locus ID 9604
UniProt ID Q9UBS8
Protein Families Druggable Genome, Transcription Factors
Gene Summary The protein encoded by this gene contains a RING zinc finger, a motif known to be involved in protein-protein interactions. This protein interacts with androgen receptor (AR) and may function as a coactivator that induces AR target gene expression in prostate. A dominant negative mutant of this gene has been demonstrated to inhibit the AR-mediated growth of prostate cancer. This protein also interacts with class III ubiquitin-conjugating enzymes (E2s) and may act as a ubiquitin-ligase (E3) in the ubiquitination of certain nuclear proteins. Six alternatively spliced transcript variants encoding two distinct isoforms have been reported. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (2) lacks an exon compared to variant 1. The translation begins at a downstream start codon and results in an isoform (2) that has a shorter N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...