Galectin 8 (LGALS8) (NM_201543) Human Untagged Clone

CAT#: SC310539

LGALS8 (untagged)-Human lectin, galactoside-binding, soluble, 8 (LGALS8), transcript variant 2



  "NM_201543" in other vectors (4)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-LGALS8 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Gal-8; PCTA-1; PCTA1; Po66-CBP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC310539 representing NM_201543.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATGTTGTCCTTAAACAACCTACAGAATATCATCTATAACCCGGTAATCCCGTTTGTTGGCACCATT
CCTGATCAGCTGGATCCTGGAACTTTGATTGTGATACGTGGGCATGTTCCTAGTGACGCAGACAGATTC
CAGGTGGATCTGCAGAATGGCAGCAGCATGAAACCTCGAGCCGATGTGGCCTTTCATTTCAATCCTCGT
TTCAAAAGGGCCGGCTGCATTGTTTGCAATACTTTGATAAATGAAAAATGGGGACGGGAAGAGATCACC
TATGACACGCCTTTCAAAAGAGAAAAGTCTTTTGAGATCGTGATTATGGTGCTGAAGGACAAATTCCAG
GTGGCTGTAAATGGAAAACATACTCTGCTCTATGGCCACAGGATCGGCCCAGAGAAAATAGACACTCTG
GGCATTTATGGCAAAGTGAATATTCACTCAATTGGTTTTAGCTTCAGCTCGGACTTACAAAGTACCCAA
GCATCTAGTCTGGAACTGACAGAGATAAGTAGAGAAAATGTTCCAAAGTCTGGCACGCCCCAGCTTAGG
CTGCCATTCGCTGCAAGGTTGAACACCCCCATGGGCCCTGGACGAACTGTCGTCGTTAAAGGAGAAGTG
AATGCAAATGCCAAAAGCTTTAATGTTGACCTACTAGCAGGAAAATCAAAGGATATTGCTCTACACTTG
AACCCACGCCTGAATATTAAAGCATTTGTAAGAAATTCTTTTCTTCAGGAGTCCTGGGGAGAAGAAGAG
AGAAATATTACCTCTTTCCCATTTAGTCCTGGGATGTACTTTGAGATGATAATTTATTGTGATGTTAGA
GAATTCAAGGTTGCAGTAAATGGCGTACACAGCCTGGAGTACAAACACAGATTTAAAGAGCTCAGCAGT
ATTGACACGCTGGAAATTAATGGAGACATCCACTTACTGGAAGTAAGGAGCTGGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_201543
Insert Size 954 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_201543.2
RefSeq Size 6155 bp
RefSeq ORF 954 bp
Locus ID 3964
UniProt ID O00214
MW 35.8 kDa
Gene Summary This gene encodes a member of the galectin family. Galectins are beta-galactoside-binding animal lectins with conserved carbohydrate recognition domains. The galectins have been implicated in many essential functions including development, differentiation, cell-cell adhesion, cell-matrix interaction, growth regulation, apoptosis, and RNA splicing. This gene is widely expressed in tumoral tissues and seems to be involved in integrin-like cell interactions. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an in-frame segment of the coding region, compared to variant 1. Variants 2 and 3 encode a shorter isoform (b) that is missing an internal segment compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: This CCDS representation uses the 5'-most in-frame start codon, which is conserved in higher primates. An alternative downstream start codon, which is more widely conserved, also exists. It is possible that leaky scanning by ribosomes would allow the downstream start codon to be used, at least some of the time. The use of the downstream start codon would result in a protein that is 1 aa shorter at the N-terminus. There is no experimental evidence showing which start codon is preferentially used in vivo.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...