CD37 (NM_001040031) Human Untagged Clone
CAT#: SC311058
CD37 (untagged)-Human CD37 molecule (CD37), transcript variant 2
CNY 3600.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GP52-40; TSPAN26 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC311058 representing NM_001040031.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGCATCGCCCTCCTGGGTTGTGTGGGGGCCCTCAAGGAGCTCCGCTGCCTCCTGGGCCTGTATTTT GGGATGCTGCTGCTCCTGTTTGCCACACAGATCACCCTGGGAATCCTCATCTCCACTCAGCGGGCCCAG CTGGAGCGAAGCTTGCGGGACGTCGTAGAGAAAACCATCCAAAAGTACGGCACCAACCCCGAGGAGACC GCGGCCGAGGAGAGCTGGGACTATGTGCAGTTCCAGCTGCGCTGCTGCGGCTGGCACTACCCGCAGGAC TGGTTCCAAGTCCTCATCCTGAGAGGTAACGGGTCGGAGGCGCACCGCGTGCCCTGCTCCTGCTACAAC TTGTCGGCGACCAACGACTCCACAATCCTAGATAAGGTGATCTTGCCCCAGCTCAGCAGGCTTGGACAC CTGGCGCGGTCCAGACACAGTGCAGACATCTGCGCTGTCCCTGCAGAGAGCCACATCTACCGCGAGGGC TGCGCGCAGGGCCTCCAGAAGTGGCTGCACAACAACCTTATTTCCATAGTGGGCATTTGCCTGGGCGTC GGCCTACTCGAGCTCGGGTTCATGACGCTCTCGATATTCCTGTGCAGAAACCTGGACCACGTCTACAAC CGGCTCGCTCGATACCGTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001040031 |
Insert Size | 642 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001040031.1 |
RefSeq Size | 1229 bp |
RefSeq ORF | 642 bp |
Locus ID | 951 |
UniProt ID | P11049 |
Protein Families | Transmembrane |
Protein Pathways | Hematopoietic cell lineage |
MW | 24 kDa |
Gene Summary | The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins and other transmembrane 4 superfamily proteins. It may play a role in T-cell-B-cell interactions. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an alternate in-frame segment in the 5' coding region and uses a downstream start codon, compared to variant 1. The encoded isoform (B) has a shorter N-terminus, compared to isoform A. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219361 | CD37 (Myc-DDK-tagged)-Human CD37 molecule (CD37), transcript variant 2 |
CNY 3840.00 |
|
RC219361L3 | Lenti-ORF clone of CD37 (Myc-DDK-tagged)-Human CD37 molecule (CD37), transcript variant 2 |
CNY 5890.00 |
|
RC219361L4 | Lenti-ORF clone of CD37 (mGFP-tagged)-Human CD37 molecule (CD37), transcript variant 2 |
CNY 5890.00 |
|
RG219361 | CD37 (tGFP-tagged) - Human CD37 molecule (CD37), transcript variant 2 |
CNY 4370.00 |