CD1E (NM_001042586) Human Untagged Clone

CAT#: SC311346

CD1E (untagged)-Human CD1e molecule (CD1E), transcript variant 5



  "NM_001042586" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-CD1E Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD1A; R2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001042586, the custom clone sequence may differ by one or more nucleotides
ATGCTGCTCCTGTTCCTCCTCTTCGAGGGTCTCTGCTGTCCTGGGGAAAATACAGCAGTG
AAGCCAGAGGCCTGGCTGTCCTGTGGCCCCAGTCCTGGCCCTGGCCGTCTGCAGCTTGTG
TGCCATGTCTCAGGATTCTACCCAAAGCCCGTGTGGGTGATGTGGATGCGGGGTGAGCAG
GAGCAGCGGGGCACTCAGCGAGGGGACGTCCTGCCTAATGCTGACGAGACATGGTATCTC
CGAGCAACCCTGGATGTGGCGGCTGGGGAGGCAGCTGGCCTGTCCTGTCGGGTGAAACAC
AGCAGTCTAGGGGGCCATGATCTAATCATCCATTGGGGTGGATATTCCATCTTTCTCATC
CTGATCTGTTTGACTGTGATAGTTACCCTGGTCATATTGGTTGTAGTTGACTCACGGTTA
AAAAAACAGAGCCCTGTCTTTCTCATGGGAGCCAACACTCAGGACACCAAGAATTCAAGA
CATCAGTTCTGCTTGGCACAAGTATCGTGGATCAAAAACAGAGTATTGAAGAAGTGGAAG
ACACGCCTAAACCAACTCTGGTGA
Restriction Sites Please inquire     
ACCN NM_001042586
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001042586.1, NP_001036051.1
RefSeq Size 1460 bp
RefSeq ORF 564 bp
Locus ID 913
UniProt ID P15812
Protein Families Druggable Genome, Transmembrane
Protein Pathways Hematopoietic cell lineage
Gene Summary This gene encodes a member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene localizes within Golgi compartments, endosomes, and lysosomes, and is cleaved into a stable soluble form. The soluble form is required for the intracellular processing of some glycolipids into a form that can be presented by other CD1 family members. Many alternatively spliced transcript variants encoding different isoforms have been described. Additional transcript variants have been found; however, their biological validity has not been determined. [provided by RefSeq, Jun 2010]
Transcript Variant: This variant (5) is missing two coding exons and uses an alternate in-frame splice site in the 3' coding region, compared to variant 1, resulting in a shorter protein (isoform e, also known as 9) compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...