UBA1 (AF258566) Human Untagged Clone

CAT#: SC312032

(untagged)-Human PP3895 mRNA, complete cds



CNY 9120.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-UBTF Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms A1S9; A1S9T; A1ST; AMCX1; CFAP124; GXP1; POC20; SMAX2; UBA1A; UBE1; UBE1X
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AF258566, the custom clone sequence may differ by one or more nucleotides
ATGGATTTCATCGTGGCTGCATCCAACCTCCGGGCAGAAAACTATGACATTCCTTCTGCA
GACCGGCACAAGAGCAAGCTGATTGCAGGGAAGATCATCCCAGCCATTGCCACGACCACA
GCAGCCGTGGTTGGCCTTGTGTGTCTGGAGCTGTACAAGGTTGTGCAGGGGCACCGACAG
CTTGACTCCTACAAGAATGGTTTCCTCAACTTGGCCCTGCCTTTCTTTGGTTTCTCTGAA
CCCCTTGCCGCACCACGTCACCAGGTGGGGGCCTGCATCCGAAGCAGGGTTTGGGTGGGG
TGTATCTGTGTAGATCTGGTTCTGATTCACGTCATACCCTGTCACCAGGGGAGGGTTTCT
GTCTGTGTACCTACCCTTTTTGTGTATCCTTTTTCACTTATTCAT
Restriction Sites Please inquire     
ACCN AF258566
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq AF258566.1, AAG23769.1
RefSeq Size 1972 bp
RefSeq ORF 408 bp
Locus ID 7317
Domains UBACT
Protein Pathways Parkinson's disease, Ubiquitin mediated proteolysis
Gene Summary The protein encoded by this gene catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation. This gene complements an X-linked mouse temperature-sensitive defect in DNA synthesis, and thus may function in DNA repair. It is part of a gene cluster on chromosome Xp11.23. Alternatively spliced transcript variants that encode the same protein have been described. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...